Gene detail

Detail information of GWHGAAZE006543

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009366538.1	1.8548E-121	PREDICTED: oxygen-evolving enhancer protein 3-2, chloroplastic [Pyrus x bretschneideri]
Swissprot	tr\|Q41932\|PSBQ2_ARATH	5E-108	Oxygen-evolving enhancer protein 3-2, chloroplastic (Precursor)
trEMBL	tr\|I1KJL7\|I1KJL7_SOYBN	2E-119	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA07G14340.1}
TAIR10	AT4G05180.1	3E-72	photosystem II subunit Q-2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	27564790	27565949	+
GWHAAZE00000002	mRNA	27564790	27565949	+
GWHAAZE00000002	exon	27564790	27565090	+
GWHAAZE00000002	exon	27565427	27565722	+
GWHAAZE00000002	exon	27565851	27565949	+
GWHAAZE00000002	CDS	27564790	27565090	+
GWHAAZE00000002	CDS	27565427	27565722	+
GWHAAZE00000002	CDS	27565851	27565949	+

Transcript Sequence
>GWHTAAZE006551 ATGGCTCAAGCCATGGCTTCAATGACTGGCTTACGCGGCTCCTCTCAAGCCGTCTTGGAAGGTAGTCTCCACCTCAGCGGCTCAATCCGCCTGACCACAGTAAACAACAGTCGCATTGCCGTGCCCAGGTCGGGGTTCACCGTCAGAGCCCAGCAAGGCTCAGCCGAGACTGAAACCAGTCGCCGAGCCCTACTGAGCCTTGTTGCCACTGGGATAGCTTCCGGTTCTTTTGTCCAAGCTGTGCTAGCTGAGGCTAAGCAAATCAAAGTTGGACCACCTCCTCCGCCCTCCGGAGGGCTACCTGGAACTCTAAACTCGGACGAGGCTAGAGACCTTGATTTACCGCTAAAGGAGAGATTTTTCATTCAACCAGTATCCCCAGCCCAGGCAGCGTTGAGGACGAAGGAATCGGCTAAAGAAATCGTGAAAGTGAAAGAATTCATTGACAAAAAGGCATGGCCTTACGTCCAAAACGATCTTCGTCTTAGGGCAGAGTACCTTCGCTATGACCTCAACACCATCATCTCTTCAAAGTCTAAAGATGAAAAAAAATCGTTCAAAGATCTCACTGGAAAGCTCTTCCAAGACATCAGCAATCTGGACCATGCAGCAAAGATAAAGAGCATTCCACAAGCAGAGAAGTACTATGCAGACACTGTGTCTAGCCTCAGTGATGTTCTTGCCAAGCTTGGTTAA

Network for GWHGAAZE006543

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05757.12	PsbQ	36	231	2.20E-82

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08901	psbQ	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015979	biological_process	photosynthesis
GO:0009523	cellular_component	photosystem II
GO:0009654	cellular_component	photosystem II oxygen evolving complex
GO:0019898	cellular_component	extrinsic component of membrane
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	761.838
	SRR3591706	second leaf	4046.628
	SRR3591707	mature leaf	3300.992
	SRR3591708	Shoot apex	1468.818
	SRR3591709	Stem	448.960
	SRR3591710	White floral bud	28.606
	SRR3591711	White flower	48.560
	SRR3591712	Green floral bud	18.265
	SRR3591713	Yellow flower	31.346
SRP173429	SRR8316895	Juvenile bud stage	187.735
	SRR8316896	Juvenile bud stage	135.724
	SRR8316897	Juvenile bud stage	154.919
	SRR8316894	Third green stage	51.214
	SRR8316900	Third green stage	53.069
	SRR8316901	Third green stage	50.553
	SRR8316898	Complete white stage	13.704
	SRR8316899	Complete white stage	19.806
	SRR8316903	Complete white stage	32.616
	SRR8316902	Silver flowering stage	9.942
	SRR8316904	Silver flowering stage	13.653
	SRR8316905	Silver flowering stage	5.609
	SRR8316906	Gold flowering stage	21.590
	SRR8316907	Gold flowering stage	21.239
	SRR8316908	Gold flowering stage	23.836
SRP132670	SRR6706286	Control	107.330
	SRR6706287	Light intensity 50%	43.959
	SRR6706288	Light intensity 20%	36.857
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	110.320
	CNS0095593	Slightly white alabastrum(diploid) 2	78.519
	CNS0095594	Slightly white alabastrum(diploid) 3	81.903
	CNS0095595	Whole white alabastrum(diploid) 2	60.337
	CNS0095596	Whole white alabastrum(diploid) 3	52.675
	CNS0095597	Whole white alabastrum(diploid) 4	37.383
	CNS0095598	Silvery flower (diploied) 1	428.773
	CNS0095599	Silvery flower (diploied) 2	354.194
	CNS0095600	Silvery flower (diploied) 3	167.530
	CNS0095601	Golden flower (diploid) 1	401.905
	CNS0095602	Golden flower (diploid) 2	288.009
	CNS0095603	Golden flower (diploid) 3	296.579
	CNS0095604	Slightly white alabastrum(tetraploid) 1	113.007
	CNS0095605	Slightly white alabastrum(tetraploid) 2	144.397
	CNS0095606	Slightly white alabastrum(tetraploid) 3	161.171
	CNS0095607	Whole white alabastrum(tetraploid) 1	61.107
	CNS0095608	Whole white alabastrum(tetraploid) 2	46.861
	CNS0095609	Whole white alabastrum(tetraploid) 3	57.912
	CNS0095610	Silvery flower (tetraploid) 1	174.715
	CNS0095611	Silvery flower (tetraploid) 2	580.933
	CNS0095612	Silvery flower (tetraploid) 3	173.369
	CNS0095613	Golden flower (tetraploid) 1	131.741
	CNS0095614	Golden flower (tetraploid) 2	230.534
	CNS0095615	Golden flower (tetraploid) 3	264.514
CRA001975	CRR073297	Stem 1	458.526
	CRR073298	Stem 2	330.819
	CRR073299	Stem 3	518.737
	CRR073300	Leaf 1	34.400
	CRR073301	Leaf 2	53.392
	CRR073302	Leaf 3	37.941
	CRR073303	Juvenile bud 1	15.044
	CRR073304	Juvenile bud 2	16.907
	CRR073305	Juvenile bud 3	26.269
	CRR073306	Third green 1	7.599
	CRR073307	Third green 2	5.681
	CRR073308	Third green 3	9.390
	CRR073309	Second white 1	46.793
	CRR073310	Second white 2	29.850
	CRR073311	Second white 3	20.838
	CRR073312	Silver flowering 1	45.933
	CRR073313	Silver flowering 2	47.947
	CRR073314	Silver flowering 3	33.547
	CRR073315	Gold flowering 1	2561.802
	CRR073316	Gold flowering 2	2475.866
	CRR073317	Gold flowering 3	2364.400
	CRR073318	Tawny withering 1	297.892
	CRR073319	Tawny withering 2	287.516
	CRR073320	Tawny withering 3	330.304