Gene detail

Detail information of GWHGAAZE006478

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004293350.1	1.117E-162	PREDICTED: alkaline ceramidase 3-like [Fragaria vesca subsp. vesca]
trEMBL	tr\|W9QL13\|W9QL13_9ROSA	5E-161	Alkaline ceramidase 3 {ECO:0000313\|EMBL:EXB39651.1}
TAIR10	AT4G22330.1	9E-124	Alkaline phytoceramidase (aPHC)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	26231824	26233350	-
GWHAAZE00000002	mRNA	26231824	26233350	-
GWHAAZE00000002	exon	26231824	26232337	-
GWHAAZE00000002	exon	26233097	26233350	-
GWHAAZE00000002	CDS	26233097	26233350	-
GWHAAZE00000002	CDS	26231824	26232337	-

Transcript Sequence
>GWHTAAZE006486 ATGGCAGATGGGATATCAAGCTTCTGGGGACCTGTTACATCCAGCACTGAGTGGTGTGAGAACAACTATGTCTACTCTTCTTACATTGCAGAATTCTACAACACCATATCCAATATCCCCTGCATTCTTTTGGCGCTTATTGGCCTTGTGAATTCCCTACGACAAGGCTTTGAGAAGAGATTTAGCGTCCTTCATGTATCGAATATGGCACTTGCTATTGGGAGCATGTTATACCATGCCACTTTGCAACACGTGCAACAGCAAGGTGATGAAACACCGATGGTATGGGAAATGCTCCTCTACATCTACATCCTATACTCGCCAGATTGGCACTACCGTAGTACAATGCCCACCTTCCTCTTCCTCTACGGCGCCGTTTTCGCAATCGCCCATTCACAGTTTCGTTTTGTATTGGGCTTTAAGGTTCATTATGTAATCCTATGTCTCTTGTGCATTCCTCGAATGTACAAATATTACATATACACAAATGATTATTGTGCTAAAAGGCTGGCAAAGTTTTATGTGGCTACCTTACTCCTCGGTAGTTTATGTTGGCTTGGCGATCATGTGTTTTGCAAAGAAAAATCAGCTTGGCCCATCAACCCCCAGGGTCATGCCATGTGGCATGTTCTGATGGGTTTCAATTCTTACTTTGCAAACACCTTCTTGATGTTTTGCCGTGCTGAGCAACGCGGATGGGCCCCAAAGGTCCAACACTTTATGGGGTGTCTCCCTTATGTGAGGATTGAGAAGCCAAAAATCCAGTAA

Network for GWHGAAZE006478

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05875.13	Ceramidase	8	237	1.90E-56

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04711	ACER3, YDC1	Metabolic pathways	map01100
K04711	ACER3, YDC1	Sphingolipid metabolism	map00600

Gene Ontology

GO term	Ontology	Name
GO:0006672	biological_process	ceramide metabolic process
GO:0016021	cellular_component	integral component of membrane
GO:0016811	molecular_function	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	54.634
	SRR3591706	second leaf	14.281
	SRR3591707	mature leaf	10.921
	SRR3591708	Shoot apex	20.141
	SRR3591709	Stem	43.861
	SRR3591710	White floral bud	26.337
	SRR3591711	White flower	35.691
	SRR3591712	Green floral bud	24.342
	SRR3591713	Yellow flower	27.780
SRP173429	SRR8316895	Juvenile bud stage	29.627
	SRR8316896	Juvenile bud stage	29.881
	SRR8316897	Juvenile bud stage	15.103
	SRR8316894	Third green stage	12.713
	SRR8316900	Third green stage	32.548
	SRR8316901	Third green stage	39.636
	SRR8316898	Complete white stage	19.081
	SRR8316899	Complete white stage	63.832
	SRR8316903	Complete white stage	22.849
	SRR8316902	Silver flowering stage	16.539
	SRR8316904	Silver flowering stage	18.973
	SRR8316905	Silver flowering stage	9.397
	SRR8316906	Gold flowering stage	37.000
	SRR8316907	Gold flowering stage	33.936
	SRR8316908	Gold flowering stage	27.817
SRP132670	SRR6706286	Control	28.800
	SRR6706287	Light intensity 50%	29.579
	SRR6706288	Light intensity 20%	30.746
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	37.287
	CNS0095593	Slightly white alabastrum(diploid) 2	44.285
	CNS0095594	Slightly white alabastrum(diploid) 3	39.398
	CNS0095595	Whole white alabastrum(diploid) 2	41.905
	CNS0095596	Whole white alabastrum(diploid) 3	31.343
	CNS0095597	Whole white alabastrum(diploid) 4	29.170
	CNS0095598	Silvery flower (diploied) 1	57.108
	CNS0095599	Silvery flower (diploied) 2	45.758
	CNS0095600	Silvery flower (diploied) 3	47.084
	CNS0095601	Golden flower (diploid) 1	35.833
	CNS0095602	Golden flower (diploid) 2	51.003
	CNS0095603	Golden flower (diploid) 3	49.982
	CNS0095604	Slightly white alabastrum(tetraploid) 1	25.882
	CNS0095605	Slightly white alabastrum(tetraploid) 2	23.944
	CNS0095606	Slightly white alabastrum(tetraploid) 3	24.299
	CNS0095607	Whole white alabastrum(tetraploid) 1	23.500
	CNS0095608	Whole white alabastrum(tetraploid) 2	23.590
	CNS0095609	Whole white alabastrum(tetraploid) 3	25.745
	CNS0095610	Silvery flower (tetraploid) 1	26.467
	CNS0095611	Silvery flower (tetraploid) 2	23.382
	CNS0095612	Silvery flower (tetraploid) 3	20.522
	CNS0095613	Golden flower (tetraploid) 1	18.378
	CNS0095614	Golden flower (tetraploid) 2	21.521
	CNS0095615	Golden flower (tetraploid) 3	26.371
CRA001975	CRR073297	Stem 1	18.421
	CRR073298	Stem 2	15.867
	CRR073299	Stem 3	17.181
	CRR073300	Leaf 1	27.722
	CRR073301	Leaf 2	32.951
	CRR073302	Leaf 3	25.234
	CRR073303	Juvenile bud 1	29.569
	CRR073304	Juvenile bud 2	25.533
	CRR073305	Juvenile bud 3	29.994
	CRR073306	Third green 1	18.119
	CRR073307	Third green 2	19.309
	CRR073308	Third green 3	19.587
	CRR073309	Second white 1	19.301
	CRR073310	Second white 2	15.066
	CRR073311	Second white 3	14.122
	CRR073312	Silver flowering 1	19.194
	CRR073313	Silver flowering 2	16.671
	CRR073314	Silver flowering 3	13.056
	CRR073315	Gold flowering 1	15.482
	CRR073316	Gold flowering 2	14.985
	CRR073317	Gold flowering 3	14.284
	CRR073318	Tawny withering 1	44.278
	CRR073319	Tawny withering 2	67.641
	CRR073320	Tawny withering 3	51.147