Gene detail

Detail information of GWHGAAZE006239

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002266460.2	3.70741E-77	PREDICTED: histidine triad nucleotide-binding protein 3 [Vitis vinifera]
Swissprot	tr\|P42856\|ZB14_MAIZE	0.000002	14 kDa zinc-binding protein
trEMBL	tr\|V4TPC1\|V4TPC1_9ROSI	6E-75	Uncharacterized protein {ECO:0000313\|EMBL:ESR53565.1}
TAIR10	AT4G16566.1	1E-54	histidine triad nucleotide-binding 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	21702698	21707243	-
GWHAAZE00000002	mRNA	21702698	21707243	-
GWHAAZE00000002	exon	21702698	21702785	-
GWHAAZE00000002	exon	21702859	21702936	-
GWHAAZE00000002	exon	21703761	21703827	-
GWHAAZE00000002	exon	21703938	21704014	-
GWHAAZE00000002	exon	21706907	21706953	-
GWHAAZE00000002	exon	21707077	21707243	-
GWHAAZE00000002	five_prime_UTR	21707164	21707243	-
GWHAAZE00000002	CDS	21707077	21707163	-
GWHAAZE00000002	CDS	21706907	21706953	-
GWHAAZE00000002	CDS	21703938	21704014	-
GWHAAZE00000002	CDS	21703761	21703827	-
GWHAAZE00000002	CDS	21702859	21702936	-
GWHAAZE00000002	CDS	21702698	21702785	-

Transcript Sequence
>GWHTAAZE006247 TCAGTTGACAACCGACTATTTTGGAAATATTGGTATGAAAGATTTGGGATTGGCGGGCCTAGATCAGATCGAAGGGAGTAATGGCGGGAGTATCATCATCATCATCATCATCGGCGTGCATCTTCTGTCAAATCGCCCGCCCTTCCACCACTACTCTCCTCCACTCCGATGAGAAGGTTGTTGCATTTCCTGACATTAAACCTGCTGCATTCAGGCATTACTTGGTAATTCCTGTGGAGCACATTTCAACTGTCAAAGACCTCCAGAAAAGAGAAGAAGACTTTGCTTTGGTTAGTCACATGTTAAATGTAGGGCAGAGTCTATTACACAGAGATTCACCTCAGTACAAGCGATACAAATTTGGTTTCCATCAGCCTCCTTTGAACAGTGTTAACCATCTGCACCTCCATTGTTTGGCACTTCCCTTTACACCCAGATGGAAACGTATAAAATACTGGCCTTTGGGACCACTTGGTGGATTCATTGAAGCCGAGAAGTTGTTGGAGAGATTAAAGCCATTATGA

Network for GWHGAAZE006239

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF11969.9	DcpS_C	13	120	7.00E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K22966	HINT4	Metabolic pathways	map01100
		Microbial metabolism in diverse environments	map01120
		Sulfur metabolism	map00920

Gene Ontology

GO term	Ontology	Name
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.374
	SRR3591706	second leaf	5.642
	SRR3591707	mature leaf	3.855
	SRR3591708	Shoot apex	5.489
	SRR3591709	Stem	6.547
	SRR3591710	White floral bud	11.674
	SRR3591711	White flower	9.834
	SRR3591712	Green floral bud	12.728
	SRR3591713	Yellow flower	11.270
SRP173429	SRR8316895	Juvenile bud stage	7.596
	SRR8316896	Juvenile bud stage	11.085
	SRR8316897	Juvenile bud stage	5.131
	SRR8316894	Third green stage	5.043
	SRR8316900	Third green stage	14.089
	SRR8316901	Third green stage	13.734
	SRR8316898	Complete white stage	8.441
	SRR8316899	Complete white stage	15.350
	SRR8316903	Complete white stage	12.249
	SRR8316902	Silver flowering stage	10.486
	SRR8316904	Silver flowering stage	17.674
	SRR8316905	Silver flowering stage	9.420
	SRR8316906	Gold flowering stage	48.838
	SRR8316907	Gold flowering stage	41.264
	SRR8316908	Gold flowering stage	40.907
SRP132670	SRR6706286	Control	12.855
	SRR6706287	Light intensity 50%	14.508
	SRR6706288	Light intensity 20%	14.992
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.096
	CNS0095593	Slightly white alabastrum(diploid) 2	12.853
	CNS0095594	Slightly white alabastrum(diploid) 3	9.368
	CNS0095595	Whole white alabastrum(diploid) 2	9.713
	CNS0095596	Whole white alabastrum(diploid) 3	9.945
	CNS0095597	Whole white alabastrum(diploid) 4	10.217
	CNS0095598	Silvery flower (diploied) 1	15.165
	CNS0095599	Silvery flower (diploied) 2	8.934
	CNS0095600	Silvery flower (diploied) 3	13.413
	CNS0095601	Golden flower (diploid) 1	10.459
	CNS0095602	Golden flower (diploid) 2	11.585
	CNS0095603	Golden flower (diploid) 3	11.437
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.062
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.230
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.349
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.481
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.927
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.653
	CNS0095610	Silvery flower (tetraploid) 1	16.969
	CNS0095611	Silvery flower (tetraploid) 2	14.149
	CNS0095612	Silvery flower (tetraploid) 3	19.136
	CNS0095613	Golden flower (tetraploid) 1	14.364
	CNS0095614	Golden flower (tetraploid) 2	21.275
	CNS0095615	Golden flower (tetraploid) 3	19.738
CRA001975	CRR073297	Stem 1	8.928
	CRR073298	Stem 2	7.337
	CRR073299	Stem 3	5.835
	CRR073300	Leaf 1	8.433
	CRR073301	Leaf 2	6.222
	CRR073302	Leaf 3	6.201
	CRR073303	Juvenile bud 1	5.975
	CRR073304	Juvenile bud 2	5.573
	CRR073305	Juvenile bud 3	3.412
	CRR073306	Third green 1	3.539
	CRR073307	Third green 2	2.302
	CRR073308	Third green 3	3.213
	CRR073309	Second white 1	4.303
	CRR073310	Second white 2	4.397
	CRR073311	Second white 3	4.739
	CRR073312	Silver flowering 1	4.344
	CRR073313	Silver flowering 2	1.685
	CRR073314	Silver flowering 3	3.044
	CRR073315	Gold flowering 1	4.645
	CRR073316	Gold flowering 2	5.352
	CRR073317	Gold flowering 3	4.758
	CRR073318	Tawny withering 1	5.200
	CRR073319	Tawny withering 2	3.011
	CRR073320	Tawny withering 3	3.954