Gene detail

Detail information of GWHGAAZE006014

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP12073.1	1.1832E-120	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9M4W3\|ISPF_CATRO	8E-112	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic (Precursor)
trEMBL	tr\|A0A068UWQ5\|A0A068UWQ5_COFCA	4E-121	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase {ECO:0000256\|RuleBase:RU004395}
TAIR10	AT1G63970.1	6E-88	isoprenoid F

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	17879210	17883386	+
GWHAAZE00000002	mRNA	17879210	17883386	+
GWHAAZE00000002	exon	17879210	17879567	+
GWHAAZE00000002	exon	17880469	17880599	+
GWHAAZE00000002	exon	17883153	17883386	+
GWHAAZE00000002	CDS	17879210	17879567	+
GWHAAZE00000002	CDS	17880469	17880599	+
GWHAAZE00000002	CDS	17883153	17883386	+

Transcript Sequence
>GWHTAAZE006022 ATGGCCATGGCGACGACTTCACTGTATTCCACCTCTCCAATCTCCGCTAAAACCACCACTAAACACCGCTTCCTCTCACCTCCTCCTCCTCCCTCAATCTCTTCCCGTACCTGCGCCGCTAGGTTCTCCACCGCTCTCTCATCGTCTCATCTCTCCCTCCGATCGTCATCCAGACCACCGCCGGTGATGGCCGTGGCCGTTGAAGTCGAGCGCCAGACCACCGCCTCTACTCCGGCCAAATCCCTGCCCTTCCGAGTAGGCCACGGCTTCGATCTCCACAGGCTGGAGCCTGGTTATCCCCTTATCATCGGCGGTATCAACATACCTCACGAAAAAGGCTGCGAGGCTCACTCCGACGGTGATGTATTGCTTCATTGTGTTGTTGATGCAATTTTGGGTGCTTTGGGGCTTCCCGATATCGGACAGATCTTTCCTGACTCTGATCCCAAGTGGAAAGGGGCTGCATCCTCTGTTTTCATCAAAGAAGCTGTGAAACTAATGGATGAAGCCGGATACGAGCTAGGAAACTTGGATGCGACTTTGATTCTTCAAAGACCAAAGCTGAGCCCACACAAGGAGTCTATCCGCTCCAACCTATCTCTGCTGCTCGGTGCAGACCCATCTGTTGTAAACCTAAAAGCAAAAACTCACGAGAAAGTTGACAGCCTCGGTGAAAATAGGAGTATTGCAGCCCACACTGTTGTTCTTCTTATGAGGAAGTAG

Network for GWHGAAZE006014

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02542.17	YgbB	84	237	1.10E-57

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01770	ispF	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name
GO:0016114	biological_process	terpenoid biosynthetic process
GO:0008685	molecular_function	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	75.336
	SRR3591706	second leaf	224.411
	SRR3591707	mature leaf	205.877
	SRR3591708	Shoot apex	120.891
	SRR3591709	Stem	65.698
	SRR3591710	White floral bud	261.994
	SRR3591711	White flower	271.363
	SRR3591712	Green floral bud	133.894
	SRR3591713	Yellow flower	382.233
SRP173429	SRR8316895	Juvenile bud stage	97.359
	SRR8316896	Juvenile bud stage	119.340
	SRR8316897	Juvenile bud stage	68.314
	SRR8316894	Third green stage	47.916
	SRR8316900	Third green stage	174.239
	SRR8316901	Third green stage	169.839
	SRR8316898	Complete white stage	156.491
	SRR8316899	Complete white stage	220.654
	SRR8316903	Complete white stage	293.836
	SRR8316902	Silver flowering stage	270.761
	SRR8316904	Silver flowering stage	333.830
	SRR8316905	Silver flowering stage	216.160
	SRR8316906	Gold flowering stage	662.631
	SRR8316907	Gold flowering stage	682.269
	SRR8316908	Gold flowering stage	690.179
SRP132670	SRR6706286	Control	240.233
	SRR6706287	Light intensity 50%	243.866
	SRR6706288	Light intensity 20%	245.306
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	168.146
	CNS0095593	Slightly white alabastrum(diploid) 2	124.143
	CNS0095594	Slightly white alabastrum(diploid) 3	149.736
	CNS0095595	Whole white alabastrum(diploid) 2	153.674
	CNS0095596	Whole white alabastrum(diploid) 3	91.752
	CNS0095597	Whole white alabastrum(diploid) 4	121.893
	CNS0095598	Silvery flower (diploied) 1	200.859
	CNS0095599	Silvery flower (diploied) 2	202.494
	CNS0095600	Silvery flower (diploied) 3	554.019
	CNS0095601	Golden flower (diploid) 1	279.504
	CNS0095602	Golden flower (diploid) 2	553.204
	CNS0095603	Golden flower (diploid) 3	537.629
	CNS0095604	Slightly white alabastrum(tetraploid) 1	94.478
	CNS0095605	Slightly white alabastrum(tetraploid) 2	111.348
	CNS0095606	Slightly white alabastrum(tetraploid) 3	177.506
	CNS0095607	Whole white alabastrum(tetraploid) 1	53.222
	CNS0095608	Whole white alabastrum(tetraploid) 2	52.827
	CNS0095609	Whole white alabastrum(tetraploid) 3	112.983
	CNS0095610	Silvery flower (tetraploid) 1	400.065
	CNS0095611	Silvery flower (tetraploid) 2	572.605
	CNS0095612	Silvery flower (tetraploid) 3	610.063
	CNS0095613	Golden flower (tetraploid) 1	519.978
	CNS0095614	Golden flower (tetraploid) 2	473.377
	CNS0095615	Golden flower (tetraploid) 3	832.006
CRA001975	CRR073297	Stem 1	111.391
	CRR073298	Stem 2	126.631
	CRR073299	Stem 3	154.919
	CRR073300	Leaf 1	140.481
	CRR073301	Leaf 2	139.396
	CRR073302	Leaf 3	149.483
	CRR073303	Juvenile bud 1	215.739
	CRR073304	Juvenile bud 2	339.849
	CRR073305	Juvenile bud 3	212.269
	CRR073306	Third green 1	617.752
	CRR073307	Third green 2	429.898
	CRR073308	Third green 3	434.216
	CRR073309	Second white 1	1019.022
	CRR073310	Second white 2	500.246
	CRR073311	Second white 3	450.381
	CRR073312	Silver flowering 1	594.885
	CRR073313	Silver flowering 2	696.793
	CRR073314	Silver flowering 3	490.850
	CRR073315	Gold flowering 1	325.370
	CRR073316	Gold flowering 2	374.098
	CRR073317	Gold flowering 3	392.068
	CRR073318	Tawny withering 1	219.222
	CRR073319	Tawny withering 2	173.316
	CRR073320	Tawny withering 3	285.752