Gene detail

Detail information of GWHGAAZE005843

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009778632.1	2.33816E-52	PREDICTED: probable cinnamyl alcohol dehydrogenase 1 [Nicotiana sylvestris]
Swissprot	tr\|Q9CAI3\|CADH1_ARATH	5E-45	Probable cinnamyl alcohol dehydrogenase 1
trEMBL	tr\|A0A061G316\|A0A061G316_THECC	5E-52	Cinnamyl alcohol dehydrogenase 1 isoform 5 {ECO:0000313\|EMBL:EOY23783.1}
TAIR10	AT1G72680.1	7E-38	cinnamyl-alcohol dehydrogenase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	14864411	14865388	+
GWHAAZE00000002	mRNA	14864411	14865388	+
GWHAAZE00000002	exon	14864411	14864499	+
GWHAAZE00000002	exon	14865044	14865079	+
GWHAAZE00000002	exon	14865178	14865388	+
GWHAAZE00000002	CDS	14864411	14864499	+
GWHAAZE00000002	CDS	14865044	14865079	+
GWHAAZE00000002	CDS	14865178	14865388	+

Transcript Sequence
>GWHTAAZE005851 ATGAGTTCACAAGCTGTGAAGGAGGAGTGTCTCGGATGGGCAGCTCGAGATCCATCTGGAGTACTATCACCTTACAAATTCAGTCGTAGGAATAAATTCGACACTCGGTATCCGTTAGTGCCTGGTCATGAGATTGTTGGAACTGTAAAGGAGGTTGGTTCCAATGTTCAGCGCTTCAAAGTTGGTGACATTGTTGGAGTTGGAACTTATGTCAACTCTTGCAGAGAGTGCGAGTATTGTAATGATGGTTTAGAAGTTCATTGCTCAAAGGGATCGGTCTTCACTTTTGATAGTATTGACGATGATGGTACCGTCACTAAAGGGGGGATATTCTAG

Network for GWHGAAZE005843

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08240.13	ADH_N	31	103	3.60E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00083	CAD	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0008270	molecular_function	zinc ion binding
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.212
	SRR3591706	second leaf	1.635
	SRR3591707	mature leaf	5.209
	SRR3591708	Shoot apex	2.964
	SRR3591709	Stem	4.289
	SRR3591710	White floral bud	6.195
	SRR3591711	White flower	8.907
	SRR3591712	Green floral bud	4.654
	SRR3591713	Yellow flower	18.943
SRP173429	SRR8316895	Juvenile bud stage	4.283
	SRR8316896	Juvenile bud stage	6.675
	SRR8316897	Juvenile bud stage	1.154
	SRR8316894	Third green stage	2.780
	SRR8316900	Third green stage	7.104
	SRR8316901	Third green stage	9.251
	SRR8316898	Complete white stage	4.502
	SRR8316899	Complete white stage	12.672
	SRR8316903	Complete white stage	5.034
	SRR8316902	Silver flowering stage	6.889
	SRR8316904	Silver flowering stage	13.051
	SRR8316905	Silver flowering stage	9.406
	SRR8316906	Gold flowering stage	16.025
	SRR8316907	Gold flowering stage	10.579
	SRR8316908	Gold flowering stage	12.726
SRP132670	SRR6706286	Control	12.697
	SRR6706287	Light intensity 50%	9.296
	SRR6706288	Light intensity 20%	9.474
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.028
	CNS0095593	Slightly white alabastrum(diploid) 2	2.177
	CNS0095594	Slightly white alabastrum(diploid) 3	2.538
	CNS0095595	Whole white alabastrum(diploid) 2	4.016
	CNS0095596	Whole white alabastrum(diploid) 3	3.498
	CNS0095597	Whole white alabastrum(diploid) 4	3.767
	CNS0095598	Silvery flower (diploied) 1	9.935
	CNS0095599	Silvery flower (diploied) 2	5.904
	CNS0095600	Silvery flower (diploied) 3	11.013
	CNS0095601	Golden flower (diploid) 1	5.704
	CNS0095602	Golden flower (diploid) 2	16.934
	CNS0095603	Golden flower (diploid) 3	16.531
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.156
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.716
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.092
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.415
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.768
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.615
	CNS0095610	Silvery flower (tetraploid) 1	12.521
	CNS0095611	Silvery flower (tetraploid) 2	5.618
	CNS0095612	Silvery flower (tetraploid) 3	5.551
	CNS0095613	Golden flower (tetraploid) 1	11.284
	CNS0095614	Golden flower (tetraploid) 2	13.966
	CNS0095615	Golden flower (tetraploid) 3	8.998
CRA001975	CRR073297	Stem 1	8.364
	CRR073298	Stem 2	7.440
	CRR073299	Stem 3	7.536
	CRR073300	Leaf 1	8.457
	CRR073301	Leaf 2	7.863
	CRR073302	Leaf 3	8.492
	CRR073303	Juvenile bud 1	9.697
	CRR073304	Juvenile bud 2	10.680
	CRR073305	Juvenile bud 3	14.031
	CRR073306	Third green 1	9.135
	CRR073307	Third green 2	9.464
	CRR073308	Third green 3	9.962
	CRR073309	Second white 1	19.944
	CRR073310	Second white 2	13.557
	CRR073311	Second white 3	13.205
	CRR073312	Silver flowering 1	20.194
	CRR073313	Silver flowering 2	20.742
	CRR073314	Silver flowering 3	13.918
	CRR073315	Gold flowering 1	7.795
	CRR073316	Gold flowering 2	12.877
	CRR073317	Gold flowering 3	12.791
	CRR073318	Tawny withering 1	8.115
	CRR073319	Tawny withering 2	7.768
	CRR073320	Tawny withering 3	8.438