Gene detail

Detail information of GWHGAAZE004768

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010240992.1	6.9309E-135	PREDICTED: minor allergen Alt a 7 isoform X1 [Nelumbo nucifera]
Swissprot	tr\|Q6NQE2\|FQRL1_ARATH	3E-134	Probable NAD(P)H dehydrogenase (quinone) FQR1-like 1 {ECO:0000305}
trEMBL	tr\|A0A067GG13\|A0A067GG13_CITSI	1E-134	Uncharacterized protein {ECO:0000313\|EMBL:KDO74382.1}
TAIR10	AT4G27270.1	2E-97	Quinone reductase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	121860153	121862551	+
GWHAAZE00000001	mRNA	121860153	121862551	+
GWHAAZE00000001	exon	121860153	121860267	+
GWHAAZE00000001	exon	121861152	121861245	+
GWHAAZE00000001	exon	121861883	121862145	+
GWHAAZE00000001	exon	121862320	121862551	+
GWHAAZE00000001	five_prime_UTR	121860153	121860244	+
GWHAAZE00000001	CDS	121860245	121860267	+
GWHAAZE00000001	CDS	121861152	121861245	+
GWHAAZE00000001	CDS	121861883	121862145	+
GWHAAZE00000001	CDS	121862320	121862551	+

Transcript Sequence
>GWHTAAZE004774 TCCCTCTCCTCCTTTGTTAATAACGTTTTCATTCACCAACCAACCACCCTCACTTTTTTCTTTTCATCACTTGCACAGAGAGCTCTTCCAAAATGGCCACTAAAGTCTATATTGTTTACTACTCAATGTATGGACATGTTGAGAAGTTGGCACAAGAGATAAAGAAAGGAGCTGCATCTGTTGAAGGAGTAGAGGCAAAATTATGGCAGGTGCCAGAAACACTGTCTGAGGAGGTTCTTGGGAAAATGAGTGCGGCACCAAAGAGTGACGTTCCATGCATTACCCCAGATGAGCTTGCTGAGGCAGATGGCCTTATCTTTGGTTTCCCAACTAGATTTGGAATGATGGCTGCTCAATTCAAAGCATTCCTCGATTCAACTGGGGGTCTATGGAGAACTCAACAACTTGCTGGCAAGCCTGCTGGCATCTTCTACAGCACTGGATCCCAAGGTGGCGGACAAGAAACTACAGCACTGACAGCCATTACACAGCTGGTGCATCACGGTATGATATTTGTGCCGATTGGATACACATTTGGGGCAGGCATGTTTGAGATGGAGAAGGTCAAGGGTGGCAGCCCCTACGGTGCTGGTACATTTGCTGGAGATGGCTCTAGACAGCCTTCTGAGCTGGAACTAGCACAAGCTTTCCACCAGGGGAAATACATTGCTAGTATTGCAAAGAAGCTAAAGGGATCTTCTTGA

Network for GWHGAAZE004768

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03358.16	FMN_red	17	144	1.40E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03809	wrbA	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Ubiquinone and other terpenoid-quinone biosynthesis	map00130

Gene Ontology

GO term	Ontology	Name
GO:0003955	molecular_function	NAD(P)H dehydrogenase (quinone) activity
GO:0010181	molecular_function	FMN binding
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	100.153
	SRR3591706	second leaf	32.345
	SRR3591707	mature leaf	81.601
	SRR3591708	Shoot apex	51.657
	SRR3591709	Stem	258.331
	SRR3591710	White floral bud	63.705
	SRR3591711	White flower	112.821
	SRR3591712	Green floral bud	30.250
	SRR3591713	Yellow flower	60.884
SRP173429	SRR8316895	Juvenile bud stage	22.506
	SRR8316896	Juvenile bud stage	35.363
	SRR8316897	Juvenile bud stage	16.390
	SRR8316894	Third green stage	9.803
	SRR8316900	Third green stage	22.858
	SRR8316901	Third green stage	28.456
	SRR8316898	Complete white stage	13.613
	SRR8316899	Complete white stage	33.254
	SRR8316903	Complete white stage	13.813
	SRR8316902	Silver flowering stage	69.545
	SRR8316904	Silver flowering stage	90.981
	SRR8316905	Silver flowering stage	57.960
	SRR8316906	Gold flowering stage	105.541
	SRR8316907	Gold flowering stage	104.713
	SRR8316908	Gold flowering stage	150.704
SRP132670	SRR6706286	Control	31.212
	SRR6706287	Light intensity 50%	25.313
	SRR6706288	Light intensity 20%	28.297
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	71.798
	CNS0095593	Slightly white alabastrum(diploid) 2	67.275
	CNS0095594	Slightly white alabastrum(diploid) 3	94.872
	CNS0095595	Whole white alabastrum(diploid) 2	46.770
	CNS0095596	Whole white alabastrum(diploid) 3	59.122
	CNS0095597	Whole white alabastrum(diploid) 4	65.203
	CNS0095598	Silvery flower (diploied) 1	45.475
	CNS0095599	Silvery flower (diploied) 2	64.182
	CNS0095600	Silvery flower (diploied) 3	79.495
	CNS0095601	Golden flower (diploid) 1	41.294
	CNS0095602	Golden flower (diploid) 2	64.126
	CNS0095603	Golden flower (diploid) 3	62.810
	CNS0095604	Slightly white alabastrum(tetraploid) 1	39.260
	CNS0095605	Slightly white alabastrum(tetraploid) 2	43.206
	CNS0095606	Slightly white alabastrum(tetraploid) 3	43.736
	CNS0095607	Whole white alabastrum(tetraploid) 1	57.452
	CNS0095608	Whole white alabastrum(tetraploid) 2	41.075
	CNS0095609	Whole white alabastrum(tetraploid) 3	23.432
	CNS0095610	Silvery flower (tetraploid) 1	123.560
	CNS0095611	Silvery flower (tetraploid) 2	100.783
	CNS0095612	Silvery flower (tetraploid) 3	42.259
	CNS0095613	Golden flower (tetraploid) 1	74.803
	CNS0095614	Golden flower (tetraploid) 2	75.278
	CNS0095615	Golden flower (tetraploid) 3	40.339
CRA001975	CRR073297	Stem 1	36.500
	CRR073298	Stem 2	33.921
	CRR073299	Stem 3	58.373
	CRR073300	Leaf 1	19.074
	CRR073301	Leaf 2	25.024
	CRR073302	Leaf 3	28.772
	CRR073303	Juvenile bud 1	18.481
	CRR073304	Juvenile bud 2	10.917
	CRR073305	Juvenile bud 3	21.693
	CRR073306	Third green 1	37.582
	CRR073307	Third green 2	59.318
	CRR073308	Third green 3	38.763
	CRR073309	Second white 1	24.208
	CRR073310	Second white 2	10.194
	CRR073311	Second white 3	4.652
	CRR073312	Silver flowering 1	2.117
	CRR073313	Silver flowering 2	6.689
	CRR073314	Silver flowering 3	8.069
	CRR073315	Gold flowering 1	52.544
	CRR073316	Gold flowering 2	51.007
	CRR073317	Gold flowering 3	62.635
	CRR073318	Tawny withering 1	229.170
	CRR073319	Tawny withering 2	258.422
	CRR073320	Tawny withering 3	163.147