Gene detail

Detail information of GWHGAAZE004237

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006598768.1	4.8241E-144	PREDICTED: TATA-box-binding protein isoform X1 [Glycine max]
COG	YP_008431875.1	5E-44	hypothetical protein N186_02405
Swissprot	tr\|Q42808\|TBP_SOYBN	8E-146	TATA-box-binding protein
trEMBL	tr\|K7MHA4\|K7MHA4_SOYBN	7E-144	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA16G25450.5} (Fragment)
TAIR10	AT1G55520.2	5E-108	TATA binding protein 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	113730778	113734646	+
GWHAAZE00000001	mRNA	113730778	113734646	+
GWHAAZE00000001	exon	113730778	113730854	+
GWHAAZE00000001	exon	113731601	113731688	+
GWHAAZE00000001	exon	113732021	113732092	+
GWHAAZE00000001	exon	113732679	113732729	+
GWHAAZE00000001	exon	113733102	113733146	+
GWHAAZE00000001	exon	113733319	113733411	+
GWHAAZE00000001	exon	113734372	113734473	+
GWHAAZE00000001	exon	113734572	113734646	+
GWHAAZE00000001	CDS	113730778	113730854	+
GWHAAZE00000001	CDS	113731601	113731688	+
GWHAAZE00000001	CDS	113732021	113732092	+
GWHAAZE00000001	CDS	113732679	113732729	+
GWHAAZE00000001	CDS	113733102	113733146	+
GWHAAZE00000001	CDS	113733319	113733411	+
GWHAAZE00000001	CDS	113734372	113734473	+
GWHAAZE00000001	CDS	113734572	113734646	+

Transcript Sequence
>GWHTAAZE004243 ATGGCGGATCAGGGCTTGGAAGGTAGTCAACCAGTGGATCTTGCTAAGCACCCATCTGGGATTGTTCCTACCCTTCAGAATATCGTCTCAACAGTCAACTTGGATTGCAAGTTGGATCTTAAGGCCATTGCATTACAAGCTCGTAATGCAGAGTACAATCCAAAGCGTTTTGCTGCTGTTATTATGAGGATAAGGGACCCGAAGACTACGGCTTTGATATTTGCTTCTGGGAAGATGGTTTGCACTGGAGCAAAGAGTGAACAACAGTCAAAATTGGCTGCAAGAAAGTATGCACGAATTATTCAAAAGCTTGGATTTCCTGCCAAATTCAAGGATTTTAAGATCCAGAATATAGTTGGCTCCTGTGATGTGAAATTTCCTATAAGACTTGAAGGTCTGGCATATTCCCATGGTGCCTTTTCAAGTTATGAACCAGAACTATTTCCAGGGCTAATATATAGAATGAAGCAACCAAAGATCGTGCTTCTCATCTTTGTGTCAGGAAAGATTGTTCTTACTGGTGCAAAGGTGAGAGATGAAACATATACAGCCTTTGAGAACATTTACCCCGTCCTTACAGAGTTCAGGAAGAACCAGCAGTAG

Network for GWHGAAZE004237

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00352.22	TBP	24	103	4.60E-33
PF00352.22	TBP	112	194	3.10E-32

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03120	TBP, tbp	Basal transcription factors	map03022

Gene Ontology

GO term	Ontology	Name
GO:0006352	biological_process	DNA-templated transcription, initiation
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	35.713
	SRR3591706	second leaf	21.834
	SRR3591707	mature leaf	32.617
	SRR3591708	Shoot apex	33.530
	SRR3591709	Stem	42.635
	SRR3591710	White floral bud	39.679
	SRR3591711	White flower	58.628
	SRR3591712	Green floral bud	36.685
	SRR3591713	Yellow flower	60.620
SRP173429	SRR8316895	Juvenile bud stage	23.473
	SRR8316896	Juvenile bud stage	25.557
	SRR8316897	Juvenile bud stage	13.534
	SRR8316894	Third green stage	10.894
	SRR8316900	Third green stage	35.428
	SRR8316901	Third green stage	31.118
	SRR8316898	Complete white stage	15.825
	SRR8316899	Complete white stage	47.605
	SRR8316903	Complete white stage	27.432
	SRR8316902	Silver flowering stage	20.628
	SRR8316904	Silver flowering stage	29.192
	SRR8316905	Silver flowering stage	14.505
	SRR8316906	Gold flowering stage	52.837
	SRR8316907	Gold flowering stage	51.354
	SRR8316908	Gold flowering stage	47.954
SRP132670	SRR6706286	Control	11.380
	SRR6706287	Light intensity 50%	12.024
	SRR6706288	Light intensity 20%	12.800
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.718
	CNS0095593	Slightly white alabastrum(diploid) 2	22.027
	CNS0095594	Slightly white alabastrum(diploid) 3	18.665
	CNS0095595	Whole white alabastrum(diploid) 2	17.694
	CNS0095596	Whole white alabastrum(diploid) 3	17.099
	CNS0095597	Whole white alabastrum(diploid) 4	19.017
	CNS0095598	Silvery flower (diploied) 1	27.876
	CNS0095599	Silvery flower (diploied) 2	32.768
	CNS0095600	Silvery flower (diploied) 3	40.182
	CNS0095601	Golden flower (diploid) 1	25.003
	CNS0095602	Golden flower (diploid) 2	42.207
	CNS0095603	Golden flower (diploid) 3	43.733
	CNS0095604	Slightly white alabastrum(tetraploid) 1	29.040
	CNS0095605	Slightly white alabastrum(tetraploid) 2	23.131
	CNS0095606	Slightly white alabastrum(tetraploid) 3	35.325
	CNS0095607	Whole white alabastrum(tetraploid) 1	23.115
	CNS0095608	Whole white alabastrum(tetraploid) 2	22.033
	CNS0095609	Whole white alabastrum(tetraploid) 3	26.662
	CNS0095610	Silvery flower (tetraploid) 1	64.511
	CNS0095611	Silvery flower (tetraploid) 2	57.746
	CNS0095612	Silvery flower (tetraploid) 3	44.007
	CNS0095613	Golden flower (tetraploid) 1	52.914
	CNS0095614	Golden flower (tetraploid) 2	60.725
	CNS0095615	Golden flower (tetraploid) 3	53.677
CRA001975	CRR073297	Stem 1	19.009
	CRR073298	Stem 2	17.172
	CRR073299	Stem 3	15.763
	CRR073300	Leaf 1	17.822
	CRR073301	Leaf 2	20.246
	CRR073302	Leaf 3	19.595
	CRR073303	Juvenile bud 1	18.951
	CRR073304	Juvenile bud 2	11.583
	CRR073305	Juvenile bud 3	20.134
	CRR073306	Third green 1	12.123
	CRR073307	Third green 2	10.215
	CRR073308	Third green 3	14.924
	CRR073309	Second white 1	12.808
	CRR073310	Second white 2	18.203
	CRR073311	Second white 3	19.353
	CRR073312	Silver flowering 1	15.629
	CRR073313	Silver flowering 2	17.972
	CRR073314	Silver flowering 3	24.893
	CRR073315	Gold flowering 1	9.931
	CRR073316	Gold flowering 2	14.087
	CRR073317	Gold flowering 3	8.530
	CRR073318	Tawny withering 1	18.949
	CRR073319	Tawny withering 2	15.439
	CRR073320	Tawny withering 3	21.246