Gene detail

Detail information of GWHGAAZE004121

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009595400.1	4.8466E-70	PREDICTED: probable calcium-binding protein CML36 [Nicotiana tomentosiformis]
COG	YP_001866396.1	4E-14	signal transduction protein
Swissprot	tr\|Q9SS31\|CML36_ARATH	4E-45	Probable calcium-binding protein CML36
trEMBL	tr\|F6HLP0\|F6HLP0_VITVI	6E-68	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB55296.1}
TAIR10	AT3G10190.1	4E-37	Calcium-binding EF-hand family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	111578038	111578976	-
GWHAAZE00000001	mRNA	111578038	111578976	-
GWHAAZE00000001	exon	111578844	111578976	-
GWHAAZE00000001	exon	111578038	111578420	-
GWHAAZE00000001	CDS	111578844	111578976	-
GWHAAZE00000001	CDS	111578038	111578420	-

Transcript Sequence
>GWHTAAZE004127 TCTTCGTCGTCGTCGTCTGATTTGGCGGAGACGAAGCTTACTGGTGAGGCGACTCCGACGAGCGTCTTGCCGCGGAATTTGCATGGATCTGAGTTTGATTTGGAACACGCGTTTAAAATTATAGATAGAGACGGTAATGGATTGATAACGAAGGCGGAACTAGAGGTTCTGTTCAGCCGAGTCGGCTTGCCCCCAAGCGAGGAGGAGCTGACAATGATGGTAAACGAGCTCGACCGCAACGGTGATGGCTGCATTAGCCTCGAGGAGTTCGGCGCAATCGGCTCGGCTTTCGGCCCGCCTGCTTGTGACGATGAGATGAGGGTGGCATTTGAGGTTTTTGATACGGATCACGATGGAAAGATCACGGCGGAGGAGTTGTTGAAGGTATTCACGGCGATCGGCGACGAGGGGTGCACGTTAGAGGACTGCCGGCGCATGATAAGTGGCGTAGATAAGAATGGGGATGGGTTCGTGTGTTTCGAGGACTTTAGGATTATGATGGAGCAGCAGAGGTGA

Network for GWHGAAZE004121

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	33	90	3.50E-14
PF13499.7	EF-hand_7	105	167	1.80E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	327.817
	SRR3591706	second leaf	48.930
	SRR3591707	mature leaf	41.651
	SRR3591708	Shoot apex	165.480
	SRR3591709	Stem	250.546
	SRR3591710	White floral bud	147.531
	SRR3591711	White flower	159.645
	SRR3591712	Green floral bud	72.792
	SRR3591713	Yellow flower	61.761
SRP173429	SRR8316895	Juvenile bud stage	150.103
	SRR8316896	Juvenile bud stage	124.171
	SRR8316897	Juvenile bud stage	156.582
	SRR8316894	Third green stage	25.837
	SRR8316900	Third green stage	46.125
	SRR8316901	Third green stage	86.687
	SRR8316898	Complete white stage	8.833
	SRR8316899	Complete white stage	176.785
	SRR8316903	Complete white stage	12.701
	SRR8316902	Silver flowering stage	24.271
	SRR8316904	Silver flowering stage	18.138
	SRR8316905	Silver flowering stage	11.683
	SRR8316906	Gold flowering stage	63.506
	SRR8316907	Gold flowering stage	50.911
	SRR8316908	Gold flowering stage	69.902
SRP132670	SRR6706286	Control	39.367
	SRR6706287	Light intensity 50%	37.835
	SRR6706288	Light intensity 20%	33.102
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	165.710
	CNS0095593	Slightly white alabastrum(diploid) 2	250.577
	CNS0095594	Slightly white alabastrum(diploid) 3	227.196
	CNS0095595	Whole white alabastrum(diploid) 2	136.303
	CNS0095596	Whole white alabastrum(diploid) 3	39.209
	CNS0095597	Whole white alabastrum(diploid) 4	114.745
	CNS0095598	Silvery flower (diploied) 1	335.757
	CNS0095599	Silvery flower (diploied) 2	299.932
	CNS0095600	Silvery flower (diploied) 3	120.454
	CNS0095601	Golden flower (diploid) 1	333.619
	CNS0095602	Golden flower (diploid) 2	187.274
	CNS0095603	Golden flower (diploid) 3	185.855
	CNS0095604	Slightly white alabastrum(tetraploid) 1	49.799
	CNS0095605	Slightly white alabastrum(tetraploid) 2	53.265
	CNS0095606	Slightly white alabastrum(tetraploid) 3	51.479
	CNS0095607	Whole white alabastrum(tetraploid) 1	52.222
	CNS0095608	Whole white alabastrum(tetraploid) 2	36.971
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.902
	CNS0095610	Silvery flower (tetraploid) 1	43.357
	CNS0095611	Silvery flower (tetraploid) 2	17.553
	CNS0095612	Silvery flower (tetraploid) 3	51.452
	CNS0095613	Golden flower (tetraploid) 1	61.637
	CNS0095614	Golden flower (tetraploid) 2	47.265
	CNS0095615	Golden flower (tetraploid) 3	34.679
CRA001975	CRR073297	Stem 1	99.404
	CRR073298	Stem 2	93.508
	CRR073299	Stem 3	86.210
	CRR073300	Leaf 1	140.340
	CRR073301	Leaf 2	210.023
	CRR073302	Leaf 3	101.794
	CRR073303	Juvenile bud 1	100.132
	CRR073304	Juvenile bud 2	120.708
	CRR073305	Juvenile bud 3	151.680
	CRR073306	Third green 1	162.467
	CRR073307	Third green 2	205.571
	CRR073308	Third green 3	153.908
	CRR073309	Second white 1	462.461
	CRR073310	Second white 2	262.388
	CRR073311	Second white 3	196.336
	CRR073312	Silver flowering 1	364.825
	CRR073313	Silver flowering 2	533.027
	CRR073314	Silver flowering 3	331.386
	CRR073315	Gold flowering 1	77.009
	CRR073316	Gold flowering 2	110.037
	CRR073317	Gold flowering 3	112.793
	CRR073318	Tawny withering 1	126.494
	CRR073319	Tawny withering 2	251.301
	CRR073320	Tawny withering 3	127.784