Gene detail

Detail information of GWHGAAZE003760

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004136503.1	5.29234E-96	PREDICTED: ubiquitin-conjugating enzyme E2 variant 1C-like [Cucumis sativus]
Swissprot	tr\|Q9SJ44\|UEV1C_ARATH	2E-95	Ubiquitin-conjugating enzyme E2 variant 1C
trEMBL	tr\|A0A0A0LE42\|A0A0A0LE42_CUCSA	2E-96	Uncharacterized protein {ECO:0000313\|EMBL:KGN59179.1}
TAIR10	AT2G36060.1	7E-71	MMS ZWEI homologue 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	103497797	103504014	+
GWHAAZE00000001	mRNA	103497797	103504014	+
GWHAAZE00000001	exon	103497797	103497934	+
GWHAAZE00000001	exon	103499938	103500063	+
GWHAAZE00000001	exon	103503874	103504014	+
GWHAAZE00000001	CDS	103497797	103497934	+
GWHAAZE00000001	CDS	103499938	103500063	+
GWHAAZE00000001	CDS	103503874	103504014	+

Transcript Sequence
>GWHTAAZE003766 CCAAGAAATTTCAGATTGTTGGAGGAACTTGAACGTGGGGAAAAGGGAATTGGAGATGGGACTGTTAGTTATGGAATGGATGATGGAGATGACATTTACATGCGTTCTTGGACTGGCACCATCATTGGTCCCCATAATTCTGTACACGAAGGTCGCATTTATCAGTTGAAGCTATTCTGTGACAAAGATTACCCAGAGAAGCCACCAAGTGTTCGTTTCCATTCTCGGATCAACATGACTTGCGTCAACCATGAGACTGGAGTGGTGGAGTCGAAGAAGTTTGGGATACTGGCGAATTGGCAGAGAGAGTACACGATGGAAGATATACTGACACAGCTCAAGAAAGAGATGGCCGCCCCTCATAACCGTAAGCTTGTCCAACCACCAGAAGGTACCTACTTCTAG

Network for GWHGAAZE003760

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	31	124	5.20E-15

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10704	UBE2V	Toll and Imd signaling pathway	map04624

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	344.973
	SRR3591706	second leaf	176.645
	SRR3591707	mature leaf	214.471
	SRR3591708	Shoot apex	237.193
	SRR3591709	Stem	394.406
	SRR3591710	White floral bud	299.257
	SRR3591711	White flower	303.536
	SRR3591712	Green floral bud	313.595
	SRR3591713	Yellow flower	278.271
SRP173429	SRR8316895	Juvenile bud stage	148.168
	SRR8316896	Juvenile bud stage	208.073
	SRR8316897	Juvenile bud stage	107.946
	SRR8316894	Third green stage	84.177
	SRR8316900	Third green stage	329.507
	SRR8316901	Third green stage	284.915
	SRR8316898	Complete white stage	145.189
	SRR8316899	Complete white stage	480.956
	SRR8316903	Complete white stage	253.111
	SRR8316902	Silver flowering stage	137.432
	SRR8316904	Silver flowering stage	167.845
	SRR8316905	Silver flowering stage	93.112
	SRR8316906	Gold flowering stage	236.630
	SRR8316907	Gold flowering stage	247.310
	SRR8316908	Gold flowering stage	258.680
SRP132670	SRR6706286	Control	278.415
	SRR6706287	Light intensity 50%	273.167
	SRR6706288	Light intensity 20%	295.385
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	227.848
	CNS0095593	Slightly white alabastrum(diploid) 2	271.110
	CNS0095594	Slightly white alabastrum(diploid) 3	233.365
	CNS0095595	Whole white alabastrum(diploid) 2	245.337
	CNS0095596	Whole white alabastrum(diploid) 3	237.964
	CNS0095597	Whole white alabastrum(diploid) 4	237.902
	CNS0095598	Silvery flower (diploied) 1	311.335
	CNS0095599	Silvery flower (diploied) 2	265.164
	CNS0095600	Silvery flower (diploied) 3	447.978
	CNS0095601	Golden flower (diploid) 1	284.085
	CNS0095602	Golden flower (diploid) 2	382.247
	CNS0095603	Golden flower (diploid) 3	387.981
	CNS0095604	Slightly white alabastrum(tetraploid) 1	231.567
	CNS0095605	Slightly white alabastrum(tetraploid) 2	222.406
	CNS0095606	Slightly white alabastrum(tetraploid) 3	338.218
	CNS0095607	Whole white alabastrum(tetraploid) 1	183.628
	CNS0095608	Whole white alabastrum(tetraploid) 2	183.723
	CNS0095609	Whole white alabastrum(tetraploid) 3	254.476
	CNS0095610	Silvery flower (tetraploid) 1	344.792
	CNS0095611	Silvery flower (tetraploid) 2	384.239
	CNS0095612	Silvery flower (tetraploid) 3	368.123
	CNS0095613	Golden flower (tetraploid) 1	272.454
	CNS0095614	Golden flower (tetraploid) 2	264.300
	CNS0095615	Golden flower (tetraploid) 3	330.367
CRA001975	CRR073297	Stem 1	419.173
	CRR073298	Stem 2	422.586
	CRR073299	Stem 3	566.301
	CRR073300	Leaf 1	537.829
	CRR073301	Leaf 2	550.994
	CRR073302	Leaf 3	651.397
	CRR073303	Juvenile bud 1	832.431
	CRR073304	Juvenile bud 2	774.166
	CRR073305	Juvenile bud 3	739.855
	CRR073306	Third green 1	571.828
	CRR073307	Third green 2	656.331
	CRR073308	Third green 3	520.085
	CRR073309	Second white 1	557.720
	CRR073310	Second white 2	333.319
	CRR073311	Second white 3	254.363
	CRR073312	Silver flowering 1	309.692
	CRR073313	Silver flowering 2	395.565
	CRR073314	Silver flowering 3	265.756
	CRR073315	Gold flowering 1	333.680
	CRR073316	Gold flowering 2	318.980
	CRR073317	Gold flowering 3	476.132
	CRR073318	Tawny withering 1	539.955
	CRR073319	Tawny withering 2	523.668
	CRR073320	Tawny withering 3	515.805