Gene detail

Detail information of GWHGAAZE003175

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009593204.1	5.99646E-67	PREDICTED: zinc finger protein ZAT11-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q9SLD4\|ZAT11_ARATH	4E-36	Zinc finger protein ZAT11
trEMBL	tr\|G8IEK9\|G8IEK9_POPTR	6E-63	C2H2-type zinc finger protein 1 {ECO:0000313\|EMBL:AES12473.1}
TAIR10	AT2G37430.1	9E-30	C2H2 and C2HC zinc fingers superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	93313885	93314325	+
GWHAAZE00000001	mRNA	93313885	93314325	+
GWHAAZE00000001	exon	93313885	93314325	+
GWHAAZE00000001	CDS	93313885	93314325	+

Transcript Sequence
>GWHTAAZE003181 ATGTTGCTTTCTCAAGGAGCCCAGGAGTATGACTTGAGCCATAGCTCTCCGAGCCGAGTCTTCGAGTGCAAGACATGTAGCCGCCAGTTCCCATCGTTCCAAGCCCTTGGGGGTCACCGAGCCAGCCACAAAAAGCCGAGGCTAATGGGAGGAGACTTGAACCTCAGCCAGTCCCAAACCTCACCGGCTAAGCCCAAAACACACGAGTGCTCCATTTGTGGGCTAGAGTTTGCAATAGGCCAAGCATTAGGCGGTCACATGAGGAGACACAGAGCTGGGTTGAACGAGAGCCAGTTGGCTTCTTCATCGGCTCAGGCTCCGGTTGTGAAGAAGGTGAATAGTAGGAGAATTTTGTGTTTAGATTTGAACTTGACACCTTATGAGAATGATTTGGAGTTTAGGCTTGGGAAGGGAGCTCCTCTCGTTGATTTCTGTTTATGA

Network for GWHGAAZE003175

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13912.7	zf-C2H2_6	20	45	5.70E-13
PF13912.7	zf-C2H2_6	68	92	6.80E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2H2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.265
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.533
	SRR3591710	White floral bud	1.330
	SRR3591711	White flower	1.665
	SRR3591712	Green floral bud	0.580
	SRR3591713	Yellow flower	18.826
SRP173429	SRR8316895	Juvenile bud stage	0.178
	SRR8316896	Juvenile bud stage	0.120
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.077
	SRR8316900	Third green stage	0.147
	SRR8316901	Third green stage	0.527
	SRR8316898	Complete white stage	0.986
	SRR8316899	Complete white stage	0.236
	SRR8316903	Complete white stage	0.034
	SRR8316902	Silver flowering stage	1.054
	SRR8316904	Silver flowering stage	1.003
	SRR8316905	Silver flowering stage	0.468
	SRR8316906	Gold flowering stage	14.834
	SRR8316907	Gold flowering stage	7.481
	SRR8316908	Gold flowering stage	28.082
SRP132670	SRR6706286	Control	1.891
	SRR6706287	Light intensity 50%	1.504
	SRR6706288	Light intensity 20%	0.642
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.099
	CNS0095593	Slightly white alabastrum(diploid) 2	3.204
	CNS0095594	Slightly white alabastrum(diploid) 3	2.332
	CNS0095595	Whole white alabastrum(diploid) 2	0.699
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.298
	CNS0095598	Silvery flower (diploied) 1	0.767
	CNS0095599	Silvery flower (diploied) 2	1.829
	CNS0095600	Silvery flower (diploied) 3	2.157
	CNS0095601	Golden flower (diploid) 1	3.235
	CNS0095602	Golden flower (diploid) 2	1.926
	CNS0095603	Golden flower (diploid) 3	2.278
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.121
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.751
	CNS0095613	Golden flower (tetraploid) 1	4.864
	CNS0095614	Golden flower (tetraploid) 2	2.472
	CNS0095615	Golden flower (tetraploid) 3	1.690
CRA001975	CRR073297	Stem 1	0.191
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.429
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.283
	CRR073306	Third green 1	0.964
	CRR073307	Third green 2	0.285
	CRR073308	Third green 3	0.376
	CRR073309	Second white 1	1.719
	CRR073310	Second white 2	3.136
	CRR073311	Second white 3	1.913
	CRR073312	Silver flowering 1	18.778
	CRR073313	Silver flowering 2	14.363
	CRR073314	Silver flowering 3	14.978
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	1.050
	CRR073317	Gold flowering 3	1.452
	CRR073318	Tawny withering 1	11.696
	CRR073319	Tawny withering 2	20.770
	CRR073320	Tawny withering 3	1.811