Gene detail

Detail information of GWHGAAZE002548

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAQ76694.1	3.09088E-39	polyphenol oxidase (chloroplast) (chloroplast) [Taraxacum officinale]
Swissprot	tr\|Q9ZP19\|PPO1_IPOBA	6E-26	Polyphenol oxidase I, chloroplastic
trEMBL	tr\|B3WFP2\|B3WFP2_TAROF	1E-39	Polyphenol oxidase {ECO:0000313\|EMBL:CAQ76694.1} (Precursor)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	81073741	81074130	+
GWHAAZE00000001	mRNA	81073741	81074130	+
GWHAAZE00000001	exon	81073741	81074130	+
GWHAAZE00000001	CDS	81073741	81074130	+

Transcript Sequence
>GWHTAAZE002552 ATGGCGAGTACTATCGACAATAAAAAACTTGGATACAAGTATCAGAATGTCGCCATCCTCTGGCTGCAAAGAAAGCCAGTACCACGTGTCAACATTCCAGCAATGAGCATCGTTTTTTCGGCGGCCTTTGACAATGTTGTCAAGGTGCTGGTCCCAAGGCCGAAAAGATCGAGGAGTAAGAAGCAAAAGGAGGCTGAGGAGGAGATTCTGGTGATCGAAGGGATAGAGTATGATCGGGAGAAGACTAAGAAGTATGTGAAGTTTGATGTTATCGTGAACGACGAGGAAGAAGAAGAGAGTGCGGCAGCTGATAAGACAGAGTTTTCGGGAAGTTTCGTGAACTTGCCACATAATCATAAGCATATGGGAAGAAGGAGACGGCTAATTTGA

Network for GWHGAAZE002548

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12142.9	PPO1_DWL	5	26	4.70E-05
PF12143.9	PPO1_KFDV	40	121	7.90E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00422	E1.10.3.1	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Tyrosine metabolism	map00350
		Isoquinoline alkaloid biosynthesis	map00950

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0004097	molecular_function	catechol oxidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.406
	SRR3591706	second leaf	3.395
	SRR3591707	mature leaf	0.426
	SRR3591708	Shoot apex	12.073
	SRR3591709	Stem	0.368
	SRR3591710	White floral bud	0.304
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.955
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.125
	SRR8316896	Juvenile bud stage	0.237
	SRR8316897	Juvenile bud stage	0.029
	SRR8316894	Third green stage	0.081
	SRR8316900	Third green stage	0.169
	SRR8316901	Third green stage	0.092
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.056
	SRR8316902	Silver flowering stage	0.042
	SRR8316904	Silver flowering stage	0.013
	SRR8316905	Silver flowering stage	0.024
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.018
	SRR6706287	Light intensity 50%	0.053
	SRR6706288	Light intensity 20%	0.058
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.214
	CNS0095593	Slightly white alabastrum(diploid) 2	0.014
	CNS0095594	Slightly white alabastrum(diploid) 3	0.129
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	1.569
	CNS0095599	Silvery flower (diploied) 2	0.618
	CNS0095600	Silvery flower (diploied) 3	0.095
	CNS0095601	Golden flower (diploid) 1	0.379
	CNS0095602	Golden flower (diploid) 2	0.252
	CNS0095603	Golden flower (diploid) 3	0.167
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.018
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.586
	CRR073298	Stem 2	0.500
	CRR073299	Stem 3	0.824
	CRR073300	Leaf 1	0.040
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.029
	CRR073303	Juvenile bud 1	0.011
	CRR073304	Juvenile bud 2	0.034
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.054
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.013
	CRR073313	Silver flowering 2	0.037
	CRR073314	Silver flowering 3	0.014
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.019
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000