Gene detail

Detail information of GWHGAAZE002518

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010036097.1	2.0531E-120	PREDICTED: chlorophyll a-b binding protein 8, chloroplastic [Eucalyptus grandis]
Swissprot	tr\|P27522\|CB13_SOLLC	2E-120	Chlorophyll a-b binding protein 8, chloroplastic (Precursor)
trEMBL	tr\|A0A059A1Q3\|A0A059A1Q3_EUCGR	8E-121	Uncharacterized protein {ECO:0000313\|EMBL:KCW47616.1}
TAIR10	AT1G61520.3	1E-84	photosystem I light harvesting complex gene 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	80456742	80457359	+
GWHAAZE00000001	mRNA	80456742	80457359	+
GWHAAZE00000001	exon	80456742	80456832	+
GWHAAZE00000001	exon	80456884	80457359	+
GWHAAZE00000001	CDS	80456742	80456832	+
GWHAAZE00000001	CDS	80456884	80457359	+

Transcript Sequence
>GWHTAAZE002522 AGCCTCCCCGGTGACTTCGGATTCGATCCGCTAGGTCTCTCGGACCCCGAGGGTACAGGTGGCTTTATCGAGCCAAAATGGTTAGCCTACGCTCCCGAGATATTTGGGAAACTCGGCCTCATACCGCCGGAAACTGCCCTTCCATGGTTCAAAACCGGTGTAATCCCCCCAGCCGGGACCTACAACTACTGGGCTGACCCATTCACCCTATTTGTATTTGAAATGGCGCTAATGGGCTTTGCGGAGCATAGGAGATTCCAAGATTGGGCCAATCCTGGGTCCATGGGGAAGCAGTACTTCTTGGGCCTAGAGAAGGGGTTTAGTGGATCGGGTGACCCGGCTTACCCCGGTGGGCCATTCTTTAATCCACTTGGGTTTGGGAAAGATGAGAAGTCAATGAAAGAGTTGAAGTTGAAGGAGATTAAGAATGGGAGGTTGGCTATGTTGGCTATTTTGGGCTATTTTATACAAGCATTGGTTACTGGGGTTGGGCCTTTCCAAAACTTACTGGACCATTTGGCTGACCCAGTTAACAACAATATCTTGACCAACCTCAAGTTCCACTGA

Network for GWHGAAZE002518

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00504.22	Chloroa_b-bind	1	158	1.40E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08909	LHCA3	Metabolic pathways	map01100
K08909	LHCA3	Photosynthesis - antenna proteins	map00196

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1037.722
	SRR3591706	second leaf	6369.549
	SRR3591707	mature leaf	7528.978
	SRR3591708	Shoot apex	2093.302
	SRR3591709	Stem	1001.187
	SRR3591710	White floral bud	94.088
	SRR3591711	White flower	145.098
	SRR3591712	Green floral bud	113.292
	SRR3591713	Yellow flower	21.470
SRP173429	SRR8316895	Juvenile bud stage	299.771
	SRR8316896	Juvenile bud stage	249.094
	SRR8316897	Juvenile bud stage	192.279
	SRR8316894	Third green stage	94.448
	SRR8316900	Third green stage	181.118
	SRR8316901	Third green stage	172.500
	SRR8316898	Complete white stage	45.132
	SRR8316899	Complete white stage	197.055
	SRR8316903	Complete white stage	77.073
	SRR8316902	Silver flowering stage	11.632
	SRR8316904	Silver flowering stage	26.546
	SRR8316905	Silver flowering stage	4.276
	SRR8316906	Gold flowering stage	12.548
	SRR8316907	Gold flowering stage	19.308
	SRR8316908	Gold flowering stage	21.822
SRP132670	SRR6706286	Control	238.474
	SRR6706287	Light intensity 50%	147.071
	SRR6706288	Light intensity 20%	135.551
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	381.365
	CNS0095593	Slightly white alabastrum(diploid) 2	320.994
	CNS0095594	Slightly white alabastrum(diploid) 3	274.081
	CNS0095595	Whole white alabastrum(diploid) 2	206.060
	CNS0095596	Whole white alabastrum(diploid) 3	141.364
	CNS0095597	Whole white alabastrum(diploid) 4	132.981
	CNS0095598	Silvery flower (diploied) 1	601.844
	CNS0095599	Silvery flower (diploied) 2	502.346
	CNS0095600	Silvery flower (diploied) 3	136.649
	CNS0095601	Golden flower (diploid) 1	475.859
	CNS0095602	Golden flower (diploid) 2	301.467
	CNS0095603	Golden flower (diploid) 3	278.806
	CNS0095604	Slightly white alabastrum(tetraploid) 1	379.026
	CNS0095605	Slightly white alabastrum(tetraploid) 2	405.949
	CNS0095606	Slightly white alabastrum(tetraploid) 3	676.117
	CNS0095607	Whole white alabastrum(tetraploid) 1	224.910
	CNS0095608	Whole white alabastrum(tetraploid) 2	156.418
	CNS0095609	Whole white alabastrum(tetraploid) 3	209.816
	CNS0095610	Silvery flower (tetraploid) 1	271.428
	CNS0095611	Silvery flower (tetraploid) 2	353.373
	CNS0095612	Silvery flower (tetraploid) 3	174.160
	CNS0095613	Golden flower (tetraploid) 1	72.872
	CNS0095614	Golden flower (tetraploid) 2	208.614
	CNS0095615	Golden flower (tetraploid) 3	62.638
CRA001975	CRR073297	Stem 1	148.089
	CRR073298	Stem 2	120.272
	CRR073299	Stem 3	234.589
	CRR073300	Leaf 1	27.239
	CRR073301	Leaf 2	41.035
	CRR073302	Leaf 3	41.420
	CRR073303	Juvenile bud 1	24.536
	CRR073304	Juvenile bud 2	24.742
	CRR073305	Juvenile bud 3	49.144
	CRR073306	Third green 1	7.238
	CRR073307	Third green 2	5.364
	CRR073308	Third green 3	12.252
	CRR073309	Second white 1	13.533
	CRR073310	Second white 2	7.434
	CRR073311	Second white 3	4.892
	CRR073312	Silver flowering 1	5.307
	CRR073313	Silver flowering 2	8.540
	CRR073314	Silver flowering 3	7.906
	CRR073315	Gold flowering 1	3911.530
	CRR073316	Gold flowering 2	3325.399
	CRR073317	Gold flowering 3	3752.955
	CRR073318	Tawny withering 1	170.075
	CRR073319	Tawny withering 2	160.832
	CRR073320	Tawny withering 3	147.648