Gene detail

Detail information of GWHGAAZE002311

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011091859.1	4.73346E-65	PREDICTED: peptidyl-prolyl cis-trans isomerase CYP22 isoform X1 [Sesamum indicum]
COG	YP_005366669.1	5E-30	peptidyl-prolyl cis-trans isomerase
Swissprot	tr\|Q9ZVJ4\|CYP22_ARATH	4E-62	Peptidyl-prolyl cis-trans isomerase CYP22
trEMBL	tr\|B9GX77\|B9GX77_POPTR	6E-64	Peptidyl-prolyl cis-trans isomerase {ECO:0000256\|RuleBase:RU000493}
TAIR10	AT2G38730.1	9E-50	Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	75502199	75504291	+
GWHAAZE00000001	mRNA	75502199	75504291	+
GWHAAZE00000001	exon	75502199	75502327	+
GWHAAZE00000001	exon	75502904	75502936	+
GWHAAZE00000001	exon	75503400	75503456	+
GWHAAZE00000001	exon	75504181	75504291	+
GWHAAZE00000001	CDS	75502199	75502327	+
GWHAAZE00000001	CDS	75502904	75502936	+
GWHAAZE00000001	CDS	75503400	75503456	+
GWHAAZE00000001	CDS	75504181	75504291	+

Transcript Sequence
>GWHTAAZE002315 ATGTCTCACCTGTTAACATTTACTTTTTATTTGCAGGGTGATGGTAGTGGATGTGTATCCATATATGGAAGTAAGTTCGAGGATGAAAATTTTGTTGCTAAGCACACGGGTCCTGGTCTCTTGTCAATGGCAAATAGTGGTCCGAATTCTAATGGGTGTCAGTTCTTTATCACCTGCGCCAAGTGTGACTGGCTTGACAATAAGCATGTAGTATTTGGGAGAGTGCTGGGGGATGGGCTGCTGGTGGTGAGAAAGATTGAGAATGTAGCTACTGGTCCCAACAACCGCCCTAAATTGGCCTGCGTTATTGCTGAATGTGGAGAGATGTAA

Network for GWHGAAZE002311

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00160.22	Pro_isomerase	24	107	5.80E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K09567	PPIH, CYPH	Spliceosome	map03040

Gene Ontology

GO term	Ontology	Name
GO:0000413	biological_process	protein peptidyl-prolyl isomerization
GO:0003755	molecular_function	peptidyl-prolyl cis-trans isomerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	59.770
	SRR3591706	second leaf	41.140
	SRR3591707	mature leaf	47.104
	SRR3591708	Shoot apex	93.826
	SRR3591709	Stem	45.009
	SRR3591710	White floral bud	48.621
	SRR3591711	White flower	62.925
	SRR3591712	Green floral bud	66.522
	SRR3591713	Yellow flower	43.692
SRP173429	SRR8316895	Juvenile bud stage	51.804
	SRR8316896	Juvenile bud stage	70.924
	SRR8316897	Juvenile bud stage	30.036
	SRR8316894	Third green stage	25.204
	SRR8316900	Third green stage	79.866
	SRR8316901	Third green stage	73.550
	SRR8316898	Complete white stage	25.565
	SRR8316899	Complete white stage	89.692
	SRR8316903	Complete white stage	35.809
	SRR8316902	Silver flowering stage	24.991
	SRR8316904	Silver flowering stage	25.129
	SRR8316905	Silver flowering stage	10.170
	SRR8316906	Gold flowering stage	45.115
	SRR8316907	Gold flowering stage	47.402
	SRR8316908	Gold flowering stage	44.577
SRP132670	SRR6706286	Control	43.667
	SRR6706287	Light intensity 50%	43.973
	SRR6706288	Light intensity 20%	47.899
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	95.235
	CNS0095593	Slightly white alabastrum(diploid) 2	98.732
	CNS0095594	Slightly white alabastrum(diploid) 3	87.719
	CNS0095595	Whole white alabastrum(diploid) 2	78.433
	CNS0095596	Whole white alabastrum(diploid) 3	78.773
	CNS0095597	Whole white alabastrum(diploid) 4	63.428
	CNS0095598	Silvery flower (diploied) 1	61.902
	CNS0095599	Silvery flower (diploied) 2	76.513
	CNS0095600	Silvery flower (diploied) 3	51.783
	CNS0095601	Golden flower (diploid) 1	72.926
	CNS0095602	Golden flower (diploid) 2	58.922
	CNS0095603	Golden flower (diploid) 3	56.145
	CNS0095604	Slightly white alabastrum(tetraploid) 1	80.412
	CNS0095605	Slightly white alabastrum(tetraploid) 2	75.934
	CNS0095606	Slightly white alabastrum(tetraploid) 3	84.495
	CNS0095607	Whole white alabastrum(tetraploid) 1	64.837
	CNS0095608	Whole white alabastrum(tetraploid) 2	43.125
	CNS0095609	Whole white alabastrum(tetraploid) 3	67.386
	CNS0095610	Silvery flower (tetraploid) 1	44.946
	CNS0095611	Silvery flower (tetraploid) 2	49.668
	CNS0095612	Silvery flower (tetraploid) 3	38.920
	CNS0095613	Golden flower (tetraploid) 1	37.059
	CNS0095614	Golden flower (tetraploid) 2	43.579
	CNS0095615	Golden flower (tetraploid) 3	29.071
CRA001975	CRR073297	Stem 1	64.125
	CRR073298	Stem 2	75.084
	CRR073299	Stem 3	76.737
	CRR073300	Leaf 1	72.134
	CRR073301	Leaf 2	69.916
	CRR073302	Leaf 3	68.226
	CRR073303	Juvenile bud 1	61.695
	CRR073304	Juvenile bud 2	52.432
	CRR073305	Juvenile bud 3	37.328
	CRR073306	Third green 1	14.256
	CRR073307	Third green 2	19.182
	CRR073308	Third green 3	19.964
	CRR073309	Second white 1	22.192
	CRR073310	Second white 2	27.094
	CRR073311	Second white 3	16.316
	CRR073312	Silver flowering 1	18.268
	CRR073313	Silver flowering 2	13.934
	CRR073314	Silver flowering 3	8.580
	CRR073315	Gold flowering 1	56.401
	CRR073316	Gold flowering 2	45.658
	CRR073317	Gold flowering 3	32.688
	CRR073318	Tawny withering 1	74.941
	CRR073319	Tawny withering 2	53.876
	CRR073320	Tawny withering 3	46.686