Gene detail

Detail information of GWHGAAZE002219

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010646980.1	7.64687E-60	PREDICTED: ankyrin repeat-containing protein At3g12360-like [Vitis vinifera]
Swissprot	tr\|Q9C7A2\|Y3236_ARATH	0.0000006	Ankyrin repeat-containing protein At3g12360
trEMBL	tr\|F6GZ72\|F6GZ72_VITVI	3E-60	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB45258.1}
TAIR10	AT3G18670.1	8E-20	Ankyrin repeat family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	73150609	73151007	-
GWHAAZE00000001	mRNA	73150609	73151007	-
GWHAAZE00000001	exon	73150609	73151007	-
GWHAAZE00000001	CDS	73150609	73151007	-

Transcript Sequence
>GWHTAAZE002223 CTCATAGCCACTGTAGCCTTTGCCGCTGCATACACAGTGCCCGGTGGCTCAAAATCCGACACAGGCACACCAGTTCTTCTCCATCACACTTTCTTTGTCGTTTTCACCGTTAGCGACGTGATATCTCTTACGTTAACTTTAACGTCAGTAATTATTTTTTTGTCAATACTGACATCGCCTTTTCGGCTAAACGACTTCAAGAATAGTCTCCCGCAGAAGTTAATGCTAGGGGTCACATTTTTGATCTTCTCTGTGTCAATGATGATGTTGGCTTTCGCGGCCACAATCATACTTATGATACAGAAAAGGGAGGAGTGGAAAAAAATTGCCTTGTATGCTGTGGCGCTTTTGCCGGTTGGCGTGTTTGCGGTCTCGTACGCACCACTCTATTTGTCTCTT

Network for GWHGAAZE002219

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13962.7	PGG	1	98	1.40E-20
PF00295.18	Glyco_hydro_28	53	375	4.10E-90
PF00295.18	Glyco_hydro_28	407	728	5.80E-90

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01184	E3.2.1.15	Metabolic pathways	map01100
K01184	E3.2.1.15	Pentose and glucuronate interconversions	map00040

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004650	molecular_function	polygalacturonase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.645
	SRR3591706	second leaf	0.625
	SRR3591707	mature leaf	0.325
	SRR3591708	Shoot apex	0.771
	SRR3591709	Stem	6.241
	SRR3591710	White floral bud	0.355
	SRR3591711	White flower	0.025
	SRR3591712	Green floral bud	0.322
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.194
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.098
	SRR8316900	Third green stage	0.197
	SRR8316901	Third green stage	0.140
	SRR8316898	Complete white stage	0.080
	SRR8316899	Complete white stage	0.042
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.129
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.177
	SRR6706287	Light intensity 50%	0.047
	SRR6706288	Light intensity 20%	0.029
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.215
	CNS0095593	Slightly white alabastrum(diploid) 2	1.043
	CNS0095594	Slightly white alabastrum(diploid) 3	0.465
	CNS0095595	Whole white alabastrum(diploid) 2	0.055
	CNS0095596	Whole white alabastrum(diploid) 3	0.103
	CNS0095597	Whole white alabastrum(diploid) 4	0.730
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.042
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.010
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.013
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.157
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.444
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.471
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.076
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.060
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.022
	CNS0095613	Golden flower (tetraploid) 1	0.686
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.042
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.103
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.522
	CRR073302	Leaf 3	0.383
	CRR073303	Juvenile bud 1	0.083
	CRR073304	Juvenile bud 2	0.005
	CRR073305	Juvenile bud 3	0.554
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.160
	CRR073316	Gold flowering 2	0.271
	CRR073317	Gold flowering 3	0.186
	CRR073318	Tawny withering 1	10.267
	CRR073319	Tawny withering 2	8.031
	CRR073320	Tawny withering 3	8.890