Gene detail

Detail information of GWHGAAZE002123

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006380732.1	2.84121E-40	hypothetical protein POPTR_0007s11750g [Populus trichocarpa]
Swissprot	tr\|Q8S8S9\|MES1_ARATH	2E-30	Methylesterase 1
trEMBL	tr\|U5G8D6\|U5G8D6_POPTR	1E-40	Uncharacterized protein {ECO:0000313\|EMBL:ERP58529.1}
TAIR10	AT2G23620.1	4E-26	methyl esterase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	69984861	69989614	+
GWHAAZE00000001	mRNA	69984861	69989614	+
GWHAAZE00000001	exon	69984861	69984983	+
GWHAAZE00000001	exon	69986860	69986985	+
GWHAAZE00000001	exon	69989330	69989614	+
GWHAAZE00000001	CDS	69984861	69984983	+
GWHAAZE00000001	CDS	69986860	69986985	+
GWHAAZE00000001	CDS	69989330	69989614	+

Transcript Sequence
>GWHTAAZE002127 ATGGAAGGGGTAAACACTTGTGTTGCTATGGAGGAGTTCGCTACAAAAGTTGCTGTTGCAATTTTTTGTACTGCTGTTATGCCCACACCCGATAATTTTGATCTTCTTCAACTCAATCAACAGTATTTCTCCGATATTCCATCTTTTGGGGATAGCAAATTTACATTTGATTCAAGTGGGGCTGCAACTGCCATTTATGTTGGTCCAAACTACTTGGCAACCACATTGTATCAACTTTCCCCTCCTGAGGATTTGACACTTTGTTTGAGCTTAGCGAGGTGGTATCCTATTTATAGAGATGAAACGTCGCGTTCGAAAACTACACTCACTTCAGCAAATTATGGATCGGTTAATCGAGCTTACATAATAAGTGAAGAAGATCAAGCAATACCTATTGCAACACAACAGCAATATATAACAAAGTTTCCACCAAAGGAAGTTGAGACGGTCTCGGGTTCTGATCATATGCTTATGCTCTCCCAACCTCAACAATTGGCCACTTACCTCCAAGAAATTGCTGCTAAGTATGTTTGA

Network for GWHGAAZE002123

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01602.21	Adaptin_N	17	259	1.10E-36
PF14796.7	AP3B1_C	456	520	2.90E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12397	AP3B	Lysosome	map04142

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0016192	biological_process	vesicle-mediated transport
GO:0030117	cellular_component	membrane coat

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.007
	SRR3591706	second leaf	0.136
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.025
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.026
	SRR3591712	Green floral bud	0.081
	SRR3591713	Yellow flower	0.009
SRP173429	SRR8316895	Juvenile bud stage	0.028
	SRR8316896	Juvenile bud stage	0.133
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.031
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.082
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.233
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.292
	SRR8316904	Silver flowering stage	0.585
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.050
SRP132670	SRR6706286	Control	5.079
	SRR6706287	Light intensity 50%	4.282
	SRR6706288	Light intensity 20%	4.870
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.057
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.060
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.119
	CNS0095600	Silvery flower (diploied) 3	0.388
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.007
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.582
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.498
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.437
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.316
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.087
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.654
	CNS0095610	Silvery flower (tetraploid) 1	0.296
	CNS0095611	Silvery flower (tetraploid) 2	0.121
	CNS0095612	Silvery flower (tetraploid) 3	0.042
	CNS0095613	Golden flower (tetraploid) 1	0.037
	CNS0095614	Golden flower (tetraploid) 2	0.161
	CNS0095615	Golden flower (tetraploid) 3	0.025
CRA001975	CRR073297	Stem 1	1.093
	CRR073298	Stem 2	2.872
	CRR073299	Stem 3	5.436
	CRR073300	Leaf 1	1.562
	CRR073301	Leaf 2	1.415
	CRR073302	Leaf 3	1.686
	CRR073303	Juvenile bud 1	1.666
	CRR073304	Juvenile bud 2	1.179
	CRR073305	Juvenile bud 3	1.403
	CRR073306	Third green 1	4.568
	CRR073307	Third green 2	6.065
	CRR073308	Third green 3	5.410
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.241
	CRR073316	Gold flowering 2	0.417
	CRR073317	Gold flowering 3	0.478
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000