Gene detail

Detail information of GWHGAAZE002037

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009768217.1	2.49501E-96	PREDICTED: probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 7 [Nicotiana sylvestris]
COG	YP_004893017.1	5E-16	trehalose-6-phosphate synthase-phosphatase
Swissprot	tr\|Q9LMI0\|TPS7_ARATH	6E-84	Probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 7
trEMBL	tr\|M1BGA0\|M1BGA0_SOLTU	2E-96	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400044501}
TAIR10	AT1G06410.1	3E-72	trehalose-phosphatase/synthase 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	67607914	67608423	-
GWHAAZE00000001	mRNA	67607914	67608423	-
GWHAAZE00000001	exon	67607914	67608423	-
GWHAAZE00000001	CDS	67607914	67608423	-

Transcript Sequence
>GWHTAAZE002041 ATGAACGAGGCAATATCAATGGCTGAACAAGAGAAACAATTACGGCATGAGAAACATTACCGTTATGTTAGCACCCACGATGTAGCTTATTGGTCTAGAAGCTTCTTGCAGGATATGGAGAGAAGTTGTGCAGACCATTTTAGGAGAAGATGTTGGGGTATTGGCTTGGGCTTTGGCTTTAGAGTTGTTGCACTAGATCCTAATTTTAGAAAGCTTTCGATAGATGATATGGTATCGGCTTATATTAAGGCTAAGCAGAGGGCCATACTTTTGGATTATGATGGCACTGTGATGCCGCAAAATTCCATCAATAAAACTCCAAGTTCACAAGTTATATCAATCTTGAACAGACTTTGTGGGGATCCAAATAATGAAGTCTTCATTGTCAGTGGAAGAGGGAGAGAAAGCTTAAGCAAATGGTTTTCTCCTTGCAGGAAGCTTGGAATTGCGGCAGAACACGGTTACTTCTTGAGGTGTGTTTTCCTTCTCCCCTTTATGAATAGAAAATAA

Network for GWHGAAZE002037

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02358.17	Trehalose_PPase	90	158	2.50E-21
PF02729.22	OTCace_N	1	71	8.20E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00611	OTC, argF, argI	Metabolic pathways	map01100
		Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of amino acids	map01230
		Starch and sucrose metabolism	map00500
		Arginine biosynthesis	map00220

Gene Ontology

GO term	Ontology	Name
GO:0005992	biological_process	trehalose biosynthetic process
GO:0006520	biological_process	cellular amino acid metabolic process
GO:0003824	molecular_function	catalytic activity
GO:0016743	molecular_function	carboxyl- or carbamoyltransferase activity
GO:0016597	molecular_function	amino acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	37.150
	SRR3591706	second leaf	20.689
	SRR3591707	mature leaf	20.042
	SRR3591708	Shoot apex	39.540
	SRR3591709	Stem	30.175
	SRR3591710	White floral bud	49.991
	SRR3591711	White flower	41.317
	SRR3591712	Green floral bud	41.428
	SRR3591713	Yellow flower	49.733
SRP173429	SRR8316895	Juvenile bud stage	23.633
	SRR8316896	Juvenile bud stage	25.226
	SRR8316897	Juvenile bud stage	14.856
	SRR8316894	Third green stage	9.644
	SRR8316900	Third green stage	26.148
	SRR8316901	Third green stage	29.049
	SRR8316898	Complete white stage	18.701
	SRR8316899	Complete white stage	40.202
	SRR8316903	Complete white stage	39.953
	SRR8316902	Silver flowering stage	20.904
	SRR8316904	Silver flowering stage	30.505
	SRR8316905	Silver flowering stage	14.686
	SRR8316906	Gold flowering stage	54.465
	SRR8316907	Gold flowering stage	49.610
	SRR8316908	Gold flowering stage	57.466
SRP132670	SRR6706286	Control	15.625
	SRR6706287	Light intensity 50%	15.897
	SRR6706288	Light intensity 20%	17.242
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.642
	CNS0095593	Slightly white alabastrum(diploid) 2	16.533
	CNS0095594	Slightly white alabastrum(diploid) 3	17.465
	CNS0095595	Whole white alabastrum(diploid) 2	15.626
	CNS0095596	Whole white alabastrum(diploid) 3	18.932
	CNS0095597	Whole white alabastrum(diploid) 4	16.654
	CNS0095598	Silvery flower (diploied) 1	33.603
	CNS0095599	Silvery flower (diploied) 2	23.791
	CNS0095600	Silvery flower (diploied) 3	56.069
	CNS0095601	Golden flower (diploid) 1	25.518
	CNS0095602	Golden flower (diploid) 2	55.369
	CNS0095603	Golden flower (diploid) 3	53.397
	CNS0095604	Slightly white alabastrum(tetraploid) 1	28.241
	CNS0095605	Slightly white alabastrum(tetraploid) 2	19.203
	CNS0095606	Slightly white alabastrum(tetraploid) 3	42.619
	CNS0095607	Whole white alabastrum(tetraploid) 1	17.494
	CNS0095608	Whole white alabastrum(tetraploid) 2	16.966
	CNS0095609	Whole white alabastrum(tetraploid) 3	36.682
	CNS0095610	Silvery flower (tetraploid) 1	49.070
	CNS0095611	Silvery flower (tetraploid) 2	56.621
	CNS0095612	Silvery flower (tetraploid) 3	55.811
	CNS0095613	Golden flower (tetraploid) 1	35.567
	CNS0095614	Golden flower (tetraploid) 2	48.857
	CNS0095615	Golden flower (tetraploid) 3	77.890
CRA001975	CRR073297	Stem 1	27.031
	CRR073298	Stem 2	25.922
	CRR073299	Stem 3	27.220
	CRR073300	Leaf 1	28.140
	CRR073301	Leaf 2	22.422
	CRR073302	Leaf 3	19.283
	CRR073303	Juvenile bud 1	24.241
	CRR073304	Juvenile bud 2	29.408
	CRR073305	Juvenile bud 3	28.761
	CRR073306	Third green 1	26.473
	CRR073307	Third green 2	21.638
	CRR073308	Third green 3	24.365
	CRR073309	Second white 1	21.259
	CRR073310	Second white 2	19.105
	CRR073311	Second white 3	19.373
	CRR073312	Silver flowering 1	19.242
	CRR073313	Silver flowering 2	21.301
	CRR073314	Silver flowering 3	14.707
	CRR073315	Gold flowering 1	16.406
	CRR073316	Gold flowering 2	23.038
	CRR073317	Gold flowering 3	20.731
	CRR073318	Tawny withering 1	22.014
	CRR073319	Tawny withering 2	18.156
	CRR073320	Tawny withering 3	17.477