Gene detail

Detail information of GWHGAAZE001894

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHN46039.1	1.81767E-22	BAHD acyltransferase [Glycine soja]
Swissprot	tr\|Q9FI40\|BAHD1_ARATH	3E-10	BAHD acyltransferase At5g47980
trEMBL	tr\|M1A5J9\|M1A5J9_SOLTU	1E-20	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400015160}
TAIR10	AT3G26040.1	9E-12	HXXXD-type acyl-transferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	63945719	63947005	-
GWHAAZE00000001	mRNA	63945719	63947005	-
GWHAAZE00000001	exon	63945719	63945904	-
GWHAAZE00000001	exon	63946169	63946446	-
GWHAAZE00000001	exon	63946834	63947005	-
GWHAAZE00000001	CDS	63946834	63947005	-
GWHAAZE00000001	CDS	63946169	63946446	-
GWHAAZE00000001	CDS	63945719	63945904	-

Transcript Sequence
>GWHTAAZE001898 ATGATCAGGAAGTATTTTGGAATTGCCGCAAGGCGCTATCATGCATTCTCAAGAGAAACCATTAAACCATCAACCCCGACCCCTTCTCATCTCAAACGCTACAATCTTTCTTCGATCGATATGGTCATGTTCCGCAATTACATACCTCTTGTTTTCTACTTCCCCAACAGTGTGACACGCCAATCAGGAGAAGAAGTGTCACCTCATTTCATCTCCTCACCTGCAAATGATCCGATCGCTATGCCAGAAGTTGTACTTCCGAAAAGGAATTGGGTCACAAAGAGGTTTGTTTTCCCCAATACCAAAATAGCTCAACTCAAAAACGTGGTTGCTTCATCGGGTGTTGAAAACCCAAGTCGAGTCGAAAGTCTATCTGCGCTACTTTATAAATGTGCAATAAGTGCAAAATCAAATTCAACAGGGTCTTTTACTCCATCAGCTATGTTCCAGATGGATTTTGGGTGGGGAAAGCCTGTGAGAGTGACTCTTGCGGATGTTCAATTTTCCAATTCCATTATTTTAATGGATACCCCAAGTGGCGATGGTATTGAAGCACAAGTCAGTTTGGACAACGAACAAGAGATGGCCGCATTTAAGCATGATAAAGAGCTTTCTGCATATGCTTCATTGCAGTGA

Network for GWHGAAZE001894

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02458.16	Transferase	83	141	7.10E-06
PF02458.16	Transferase	146	204	5.20E-08
PF12799.8	LRR_4	247	287	3.30E-07
PF13855.7	LRR_8	320	379	1.90E-07
PF00069.26	Pkinase	473	735	6.80E-44

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-XI-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding
GO:0005515	molecular_function	protein binding
GO:0016747	molecular_function	transferase activity, transferring acyl groups other than amino-acyl groups

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.113
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.637
SRP173429	SRR8316895	Juvenile bud stage	0.129
	SRR8316896	Juvenile bud stage	0.659
	SRR8316897	Juvenile bud stage	0.059
	SRR8316894	Third green stage	0.226
	SRR8316900	Third green stage	0.224
	SRR8316901	Third green stage	0.336
	SRR8316898	Complete white stage	0.102
	SRR8316899	Complete white stage	0.299
	SRR8316903	Complete white stage	0.164
	SRR8316902	Silver flowering stage	0.300
	SRR8316904	Silver flowering stage	0.868
	SRR8316905	Silver flowering stage	0.278
	SRR8316906	Gold flowering stage	6.372
	SRR8316907	Gold flowering stage	1.928
	SRR8316908	Gold flowering stage	12.766
SRP132670	SRR6706286	Control	0.403
	SRR6706287	Light intensity 50%	0.694
	SRR6706288	Light intensity 20%	0.153
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.097
	CNS0095593	Slightly white alabastrum(diploid) 2	0.956
	CNS0095594	Slightly white alabastrum(diploid) 3	0.638
	CNS0095595	Whole white alabastrum(diploid) 2	0.156
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.749
	CNS0095598	Silvery flower (diploied) 1	0.856
	CNS0095599	Silvery flower (diploied) 2	0.239
	CNS0095600	Silvery flower (diploied) 3	1.132
	CNS0095601	Golden flower (diploid) 1	1.856
	CNS0095602	Golden flower (diploid) 2	0.887
	CNS0095603	Golden flower (diploid) 3	0.964
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.062
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.114
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.077
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.423
	CNS0095611	Silvery flower (tetraploid) 2	0.027
	CNS0095612	Silvery flower (tetraploid) 3	0.518
	CNS0095613	Golden flower (tetraploid) 1	0.866
	CNS0095614	Golden flower (tetraploid) 2	1.890
	CNS0095615	Golden flower (tetraploid) 3	0.074
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.078
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.003
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.145
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.351
	CRR073310	Second white 2	0.083
	CRR073311	Second white 3	0.264
	CRR073312	Silver flowering 1	4.171
	CRR073313	Silver flowering 2	3.786
	CRR073314	Silver flowering 3	1.942
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.541
	CRR073317	Gold flowering 3	1.465
	CRR073318	Tawny withering 1	6.776
	CRR073319	Tawny withering 2	13.595
	CRR073320	Tawny withering 3	1.189