Gene detail

Detail information of GWHGAAZE001444

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002283248.2	8.82362E-92	PREDICTED: octanoyltransferase isoform X3 [Vitis vinifera]
Swissprot	tr\|Q9SXP7\|LIPB_ARATH	1E-90	Octanoyltransferase
trEMBL	tr\|F6GUD8\|F6GUD8_VITVI	2E-91	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43759.1}
TAIR10	AT1G04640.2	2E-72	lipoyltransferase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	43301988	43302500	-
GWHAAZE00000001	mRNA	43301988	43302500	-
GWHAAZE00000001	exon	43301988	43302500	-
GWHAAZE00000001	CDS	43301988	43302500	-

Transcript Sequence
>GWHTAAZE001448 ATGGGCACTGTCAACTACCTGGACGCACTTAAGCTGCAGGTGAAGCTTGCTTCTGATAGAAAAACCGGTACGATTCCCGATACTCTTCTCTCTCTACAGCACCCACCTACGTATACCCTTGGAAAGCGCCGGACCGATCACAATTTACTAGTTCCCGAGTCTGAACTCAAAACTATGGGGGCGGAGCTTCACTACACACAAAGGGGAGGGGATATTACATTTCATGGACCCCACCAAGCAATCTTATATCCCATTATATCTTTGAGGGATGTAGGCATTGGTGCTAGAAATTATGTTGAAAAACTTGAGTTAACTATGATTGAATTAGCGTCTATTTATGGTGTGAATGCTCGTCCAGGAGGAAAATGTGAGACTGGGGTTTGGGTTGGAGAGCGAAAAATTGGGGCAATTGGGGTTCAAATTTCATCTGGGATTACTTCTCATGGGTTGGCTTTTAATATTAATCGATTTAAGCTACTTCAAGCATATTGTGCCTTGTGGGATTATGGATAA

Network for GWHGAAZE001444

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03099.20	BPL_LplA_LipB	49	154	1.00E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K23735	LIPT2, LIP2	Metabolic pathways	map01100
K23735	LIPT2, LIP2	Lipoic acid metabolism	map00785

Gene Ontology

GO term	Ontology	Name
GO:0009249	biological_process	protein lipoylation
GO:0006464	biological_process	cellular protein modification process
GO:0033819	molecular_function	lipoyl(octanoyl) transferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.518
	SRR3591706	second leaf	1.380
	SRR3591707	mature leaf	2.153
	SRR3591708	Shoot apex	4.130
	SRR3591709	Stem	4.617
	SRR3591710	White floral bud	1.714
	SRR3591711	White flower	1.639
	SRR3591712	Green floral bud	1.118
	SRR3591713	Yellow flower	1.860
SRP173429	SRR8316895	Juvenile bud stage	3.742
	SRR8316896	Juvenile bud stage	5.510
	SRR8316897	Juvenile bud stage	1.157
	SRR8316894	Third green stage	2.269
	SRR8316900	Third green stage	5.280
	SRR8316901	Third green stage	6.362
	SRR8316898	Complete white stage	3.105
	SRR8316899	Complete white stage	8.364
	SRR8316903	Complete white stage	4.080
	SRR8316902	Silver flowering stage	2.463
	SRR8316904	Silver flowering stage	3.281
	SRR8316905	Silver flowering stage	2.135
	SRR8316906	Gold flowering stage	8.159
	SRR8316907	Gold flowering stage	7.827
	SRR8316908	Gold flowering stage	8.071
SRP132670	SRR6706286	Control	7.414
	SRR6706287	Light intensity 50%	7.378
	SRR6706288	Light intensity 20%	7.702
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.854
	CNS0095593	Slightly white alabastrum(diploid) 2	5.808
	CNS0095594	Slightly white alabastrum(diploid) 3	4.872
	CNS0095595	Whole white alabastrum(diploid) 2	5.141
	CNS0095596	Whole white alabastrum(diploid) 3	5.363
	CNS0095597	Whole white alabastrum(diploid) 4	7.267
	CNS0095598	Silvery flower (diploied) 1	4.226
	CNS0095599	Silvery flower (diploied) 2	2.255
	CNS0095600	Silvery flower (diploied) 3	4.851
	CNS0095601	Golden flower (diploid) 1	2.454
	CNS0095602	Golden flower (diploid) 2	6.046
	CNS0095603	Golden flower (diploid) 3	6.026
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.593
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.836
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.832
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.353
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.338
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.864
	CNS0095610	Silvery flower (tetraploid) 1	7.376
	CNS0095611	Silvery flower (tetraploid) 2	8.054
	CNS0095612	Silvery flower (tetraploid) 3	7.278
	CNS0095613	Golden flower (tetraploid) 1	8.089
	CNS0095614	Golden flower (tetraploid) 2	5.338
	CNS0095615	Golden flower (tetraploid) 3	9.233
CRA001975	CRR073297	Stem 1	7.062
	CRR073298	Stem 2	7.958
	CRR073299	Stem 3	5.250
	CRR073300	Leaf 1	8.072
	CRR073301	Leaf 2	8.875
	CRR073302	Leaf 3	6.630
	CRR073303	Juvenile bud 1	6.953
	CRR073304	Juvenile bud 2	6.314
	CRR073305	Juvenile bud 3	6.231
	CRR073306	Third green 1	4.072
	CRR073307	Third green 2	3.417
	CRR073308	Third green 3	4.512
	CRR073309	Second white 1	5.406
	CRR073310	Second white 2	4.481
	CRR073311	Second white 3	5.153
	CRR073312	Silver flowering 1	4.818
	CRR073313	Silver flowering 2	3.621
	CRR073314	Silver flowering 3	5.218
	CRR073315	Gold flowering 1	8.216
	CRR073316	Gold flowering 2	7.421
	CRR073317	Gold flowering 3	5.994
	CRR073318	Tawny withering 1	11.449
	CRR073319	Tawny withering 2	5.953
	CRR073320	Tawny withering 3	7.335