Gene detail

Detail information of GWHGAAZE001271

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010247241.1	3.89175E-51	PREDICTED: putative methyltransferase At1g22800 [Nelumbo nucifera]
Swissprot	tr\|O80543\|Y1280_ARATH	2E-50	Putative methyltransferase At1g22800
trEMBL	tr\|W9RWX9\|W9RWX9_9ROSA	1E-49	Uncharacterized protein {ECO:0000313\|EMBL:EXC01132.1}
TAIR10	AT1G22800.1	6E-42	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	29722673	29725480	+
GWHAAZE00000001	mRNA	29722673	29725480	+
GWHAAZE00000001	exon	29722673	29722747	+
GWHAAZE00000001	exon	29723210	29723299	+
GWHAAZE00000001	exon	29725352	29725480	+
GWHAAZE00000001	CDS	29722673	29722747	+
GWHAAZE00000001	CDS	29723210	29723299	+
GWHAAZE00000001	CDS	29725352	29725480	+

Transcript Sequence
>GWHTAAZE001275 ATGGATGTAGCTATGGAGCTTATAGAGCATCTGCGTGCAATGGGTGAAACTAATGCTCTTCTACAGAGGAACAAAATCTTGAAGAGAGAAACTGCACTGGCAACTGCCGCTGTTTACGAGTCAATGTTTGCAGCAGAGGATGGCACCATTCCAGCAACCTTCCAGGTTATATACATGACAGGATGGAGGGAACACTCTTCACATCAGAAGGCTAAAAGGAGGGGATCTGCCACTGTATCATTCCAAGATCTTCAGAAGCAGTTTGGCAGTGGTAATCTCTCTTTCTCTATATAA

Network for GWHGAAZE001271

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K18162	NDUFAF5	Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.526
	SRR3591706	second leaf	1.250
	SRR3591707	mature leaf	1.166
	SRR3591708	Shoot apex	2.798
	SRR3591709	Stem	3.299
	SRR3591710	White floral bud	3.446
	SRR3591711	White flower	3.110
	SRR3591712	Green floral bud	7.916
	SRR3591713	Yellow flower	2.073
SRP173429	SRR8316895	Juvenile bud stage	4.335
	SRR8316896	Juvenile bud stage	7.627
	SRR8316897	Juvenile bud stage	13.051
	SRR8316894	Third green stage	3.462
	SRR8316900	Third green stage	7.332
	SRR8316901	Third green stage	10.189
	SRR8316898	Complete white stage	2.570
	SRR8316899	Complete white stage	9.012
	SRR8316903	Complete white stage	1.462
	SRR8316902	Silver flowering stage	1.474
	SRR8316904	Silver flowering stage	2.971
	SRR8316905	Silver flowering stage	1.019
	SRR8316906	Gold flowering stage	4.980
	SRR8316907	Gold flowering stage	6.477
	SRR8316908	Gold flowering stage	17.313
SRP132670	SRR6706286	Control	5.842
	SRR6706287	Light intensity 50%	5.032
	SRR6706288	Light intensity 20%	5.734
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.029
	CNS0095593	Slightly white alabastrum(diploid) 2	10.015
	CNS0095594	Slightly white alabastrum(diploid) 3	8.548
	CNS0095595	Whole white alabastrum(diploid) 2	4.863
	CNS0095596	Whole white alabastrum(diploid) 3	5.653
	CNS0095597	Whole white alabastrum(diploid) 4	5.990
	CNS0095598	Silvery flower (diploied) 1	3.506
	CNS0095599	Silvery flower (diploied) 2	3.731
	CNS0095600	Silvery flower (diploied) 3	4.677
	CNS0095601	Golden flower (diploid) 1	5.047
	CNS0095602	Golden flower (diploid) 2	2.371
	CNS0095603	Golden flower (diploid) 3	2.819
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.206
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.284
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.150
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.800
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.778
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.005
	CNS0095610	Silvery flower (tetraploid) 1	6.451
	CNS0095611	Silvery flower (tetraploid) 2	8.064
	CNS0095612	Silvery flower (tetraploid) 3	7.254
	CNS0095613	Golden flower (tetraploid) 1	8.659
	CNS0095614	Golden flower (tetraploid) 2	5.477
	CNS0095615	Golden flower (tetraploid) 3	7.095
CRA001975	CRR073297	Stem 1	10.167
	CRR073298	Stem 2	7.591
	CRR073299	Stem 3	4.715
	CRR073300	Leaf 1	8.070
	CRR073301	Leaf 2	9.273
	CRR073302	Leaf 3	5.260
	CRR073303	Juvenile bud 1	4.912
	CRR073304	Juvenile bud 2	3.596
	CRR073305	Juvenile bud 3	5.630
	CRR073306	Third green 1	1.758
	CRR073307	Third green 2	0.356
	CRR073308	Third green 3	0.325
	CRR073309	Second white 1	1.371
	CRR073310	Second white 2	1.499
	CRR073311	Second white 3	1.501
	CRR073312	Silver flowering 1	0.519
	CRR073313	Silver flowering 2	1.125
	CRR073314	Silver flowering 3	0.610
	CRR073315	Gold flowering 1	1.691
	CRR073316	Gold flowering 2	3.397
	CRR073317	Gold flowering 3	3.637
	CRR073318	Tawny withering 1	5.856
	CRR073319	Tawny withering 2	2.760
	CRR073320	Tawny withering 3	5.647