Gene detail

Detail information of GWHGAAZE001241

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010104531.1	2.95573E-23	Uncharacterized protein L484_025505 [Morus notabilis]
Swissprot	tr\|O80543\|Y1280_ARATH	5E-13	Putative methyltransferase At1g22800
trEMBL	tr\|M1BPM0\|M1BPM0_SOLTU	1E-23	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400049966}
TAIR10	AT1G22800.1	3E-11	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	28980619	28984321	+
GWHAAZE00000001	mRNA	28980619	28984321	+
GWHAAZE00000001	exon	28980619	28980742	+
GWHAAZE00000001	exon	28982154	28982424	+
GWHAAZE00000001	exon	28983800	28983880	+
GWHAAZE00000001	exon	28984268	28984321	+
GWHAAZE00000001	five_prime_UTR	28980619	28980742	+
GWHAAZE00000001	five_prime_UTR	28982154	28982292	+
GWHAAZE00000001	CDS	28982293	28982424	+
GWHAAZE00000001	CDS	28983800	28983880	+
GWHAAZE00000001	CDS	28984268	28984321	+

Transcript Sequence
>GWHTAAZE001243 CACCACTCGAAGCCGTCTCCCCCTTTACAATACGAAGCTCGTCTTCCTTCATCAAGCAAATTTCCCACGAACCAATTTTGATAAAAATCCAGGGTTTTTTACTTGTTACAAACTCTTATTGGAGCTTACCATCAAATAGTTTGGACTGCCCAAACTGGACTTTATACTCAGCATCATCAAGATTTTCCATTCCAAAATCATAGGTGCCGGCCCAAAAGAAAAAGATCCCAAGCAGTGCCATCGTGCGATAAAGTGAAGCAGATATGAGAGGAAGGTGCGGAGCTCTTTCTCATAATGGTTTACGACTATGGAGAAGATCATTCTGTACAGATAATATGGATGGGTTGCAGAGCTCCAAGGTTAAAATCTTTGATCGCTTCCTGAAACGCAAACAACGTGACCGAGCTGCATGGTTAATGGGTCCAAATGATTCTTTGGTTGATAATGTGGCAGAGAATCTGCTGGATCGCTTGGAGCATTTTCCTGTACCTGCATGTCTGCATACAAAGAGAAAGCCAAAAGGTAGCTAG

Network for GWHGAAZE001241

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K18162	NDUFAF5	Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.152
	SRR3591706	second leaf	3.519
	SRR3591707	mature leaf	4.769
	SRR3591708	Shoot apex	7.434
	SRR3591709	Stem	6.234
	SRR3591710	White floral bud	6.229
	SRR3591711	White flower	4.235
	SRR3591712	Green floral bud	8.355
	SRR3591713	Yellow flower	6.233
SRP173429	SRR8316895	Juvenile bud stage	3.974
	SRR8316896	Juvenile bud stage	3.722
	SRR8316897	Juvenile bud stage	9.171
	SRR8316894	Third green stage	1.677
	SRR8316900	Third green stage	5.161
	SRR8316901	Third green stage	6.125
	SRR8316898	Complete white stage	2.183
	SRR8316899	Complete white stage	5.870
	SRR8316903	Complete white stage	2.583
	SRR8316902	Silver flowering stage	1.550
	SRR8316904	Silver flowering stage	2.124
	SRR8316905	Silver flowering stage	1.157
	SRR8316906	Gold flowering stage	3.968
	SRR8316907	Gold flowering stage	2.963
	SRR8316908	Gold flowering stage	10.813
SRP132670	SRR6706286	Control	5.295
	SRR6706287	Light intensity 50%	5.740
	SRR6706288	Light intensity 20%	6.371
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.830
	CNS0095593	Slightly white alabastrum(diploid) 2	1.107
	CNS0095594	Slightly white alabastrum(diploid) 3	1.401
	CNS0095595	Whole white alabastrum(diploid) 2	2.369
	CNS0095596	Whole white alabastrum(diploid) 3	3.282
	CNS0095597	Whole white alabastrum(diploid) 4	2.526
	CNS0095598	Silvery flower (diploied) 1	1.232
	CNS0095599	Silvery flower (diploied) 2	3.908
	CNS0095600	Silvery flower (diploied) 3	3.275
	CNS0095601	Golden flower (diploid) 1	2.664
	CNS0095602	Golden flower (diploid) 2	3.088
	CNS0095603	Golden flower (diploid) 3	3.239
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.079
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.960
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.399
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.096
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.081
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.092
	CNS0095610	Silvery flower (tetraploid) 1	9.646
	CNS0095611	Silvery flower (tetraploid) 2	9.847
	CNS0095612	Silvery flower (tetraploid) 3	9.529
	CNS0095613	Golden flower (tetraploid) 1	4.865
	CNS0095614	Golden flower (tetraploid) 2	7.613
	CNS0095615	Golden flower (tetraploid) 3	12.105
CRA001975	CRR073297	Stem 1	4.957
	CRR073298	Stem 2	2.351
	CRR073299	Stem 3	4.157
	CRR073300	Leaf 1	3.364
	CRR073301	Leaf 2	4.262
	CRR073302	Leaf 3	3.810
	CRR073303	Juvenile bud 1	2.431
	CRR073304	Juvenile bud 2	2.580
	CRR073305	Juvenile bud 3	2.640
	CRR073306	Third green 1	0.403
	CRR073307	Third green 2	0.675
	CRR073308	Third green 3	1.076
	CRR073309	Second white 1	2.160
	CRR073310	Second white 2	1.087
	CRR073311	Second white 3	1.596
	CRR073312	Silver flowering 1	0.557
	CRR073313	Silver flowering 2	1.449
	CRR073314	Silver flowering 3	0.970
	CRR073315	Gold flowering 1	3.498
	CRR073316	Gold flowering 2	4.479
	CRR073317	Gold flowering 3	1.733
	CRR073318	Tawny withering 1	2.850
	CRR073319	Tawny withering 2	1.109
	CRR073320	Tawny withering 3	0.986