Gene detail

Detail information of GWHGAAZE001181

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006340315.1	5.36328E-20	PREDICTED: putative axial regulator YABBY 2-like [Solanum tuberosum]
Swissprot	tr\|Q10FZ7\|YAB2_ORYSJ	1E-10	Protein YABBY 2
trEMBL	tr\|M0ZTF6\|M0ZTF6_SOLTU	2E-20	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400007731}
TAIR10	AT2G26580.2	0.00000008	plant-specific transcription factor YABBY family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	27092697	27094098	+
GWHAAZE00000001	mRNA	27092697	27094098	+
GWHAAZE00000001	exon	27092697	27092819	+
GWHAAZE00000001	exon	27093877	27094098	+
GWHAAZE00000001	CDS	27092697	27092819	+
GWHAAZE00000001	CDS	27093877	27094098	+

Transcript Sequence
>GWHTAAZE001183 GTAAGTGTTCCATGCAGCAGTATGTGCACCATTGTGACTGTGAGATGTGGGCATTGTGCAAATTTGCTGTCTGTTAGCATGGGAACCTTGCTTCAGACACTTCCTCTCCAAGATGTTCAACAGAAGTTGCAGAAACAACAATCCAGCAGCATTGAATTACATGGTAGTAACAAGGAGTACATGAGTGGCTCATCATCATCATCTTCTAAATGCATCAACAAGTTTTCATCATTCAAGCCACCGCCTCCTCCTCCAAATGCTGACCATGACCCACCAAGAGTCTCTCACATCCGCCGTGAGTTCCTTCTCTCTAACCCCCACCCCACCCCACCCCCAAAAACATAA

Network for GWHGAAZE001181

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04690.14	YABBY	1	72	8.00E-17

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-YABBY

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0007275	biological_process	multicellular organism development

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.054
	SRR3591706	second leaf	10.998
	SRR3591707	mature leaf	9.829
	SRR3591708	Shoot apex	21.477
	SRR3591709	Stem	0.732
	SRR3591710	White floral bud	76.700
	SRR3591711	White flower	55.738
	SRR3591712	Green floral bud	42.596
	SRR3591713	Yellow flower	52.140
SRP173429	SRR8316895	Juvenile bud stage	8.880
	SRR8316896	Juvenile bud stage	11.108
	SRR8316897	Juvenile bud stage	1.895
	SRR8316894	Third green stage	7.922
	SRR8316900	Third green stage	28.648
	SRR8316901	Third green stage	24.396
	SRR8316898	Complete white stage	32.552
	SRR8316899	Complete white stage	66.058
	SRR8316903	Complete white stage	51.654
	SRR8316902	Silver flowering stage	12.619
	SRR8316904	Silver flowering stage	22.613
	SRR8316905	Silver flowering stage	8.724
	SRR8316906	Gold flowering stage	28.374
	SRR8316907	Gold flowering stage	22.953
	SRR8316908	Gold flowering stage	19.420
SRP132670	SRR6706286	Control	66.958
	SRR6706287	Light intensity 50%	67.499
	SRR6706288	Light intensity 20%	66.793
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.731
	CNS0095593	Slightly white alabastrum(diploid) 2	14.629
	CNS0095594	Slightly white alabastrum(diploid) 3	10.180
	CNS0095595	Whole white alabastrum(diploid) 2	14.366
	CNS0095596	Whole white alabastrum(diploid) 3	11.025
	CNS0095597	Whole white alabastrum(diploid) 4	17.955
	CNS0095598	Silvery flower (diploied) 1	16.201
	CNS0095599	Silvery flower (diploied) 2	13.641
	CNS0095600	Silvery flower (diploied) 3	29.779
	CNS0095601	Golden flower (diploid) 1	11.912
	CNS0095602	Golden flower (diploid) 2	32.894
	CNS0095603	Golden flower (diploid) 3	31.876
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.864
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.472
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.978
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.922
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.488
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.378
	CNS0095610	Silvery flower (tetraploid) 1	17.071
	CNS0095611	Silvery flower (tetraploid) 2	13.069
	CNS0095612	Silvery flower (tetraploid) 3	13.884
	CNS0095613	Golden flower (tetraploid) 1	14.378
	CNS0095614	Golden flower (tetraploid) 2	12.402
	CNS0095615	Golden flower (tetraploid) 3	13.105
CRA001975	CRR073297	Stem 1	38.436
	CRR073298	Stem 2	30.623
	CRR073299	Stem 3	32.239
	CRR073300	Leaf 1	58.500
	CRR073301	Leaf 2	53.626
	CRR073302	Leaf 3	49.725
	CRR073303	Juvenile bud 1	60.644
	CRR073304	Juvenile bud 2	75.749
	CRR073305	Juvenile bud 3	58.570
	CRR073306	Third green 1	72.167
	CRR073307	Third green 2	65.758
	CRR073308	Third green 3	71.658
	CRR073309	Second white 1	46.171
	CRR073310	Second white 2	45.976
	CRR073311	Second white 3	29.519
	CRR073312	Silver flowering 1	14.287
	CRR073313	Silver flowering 2	16.368
	CRR073314	Silver flowering 3	20.164
	CRR073315	Gold flowering 1	12.165
	CRR073316	Gold flowering 2	7.498
	CRR073317	Gold flowering 3	6.921
	CRR073318	Tawny withering 1	0.215
	CRR073319	Tawny withering 2	2.646
	CRR073320	Tawny withering 3	0.690