Gene detail

Detail information of GWHGAAZE000879

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010104122.1	5.85375E-69	General transcription factor IIH subunit 2 [Morus notabilis]
trEMBL	tr\|W9RVY0\|W9RVY0_9ROSA	2E-69	General transcription factor IIH subunit 2 {ECO:0000313\|EMBL:EXB98563.1}
TAIR10	AT1G05055.1	7E-54	general transcription factor II H2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	18686812	18689891	-
GWHAAZE00000001	mRNA	18686812	18689891	-
GWHAAZE00000001	exon	18689526	18689891	-
GWHAAZE00000001	exon	18686812	18686988	-
GWHAAZE00000001	CDS	18689526	18689891	-
GWHAAZE00000001	CDS	18686812	18686988	-

Transcript Sequence
>GWHTAAZE000881 ATGGATTTTCAAGCAAGTCGAATGATGGTAGTTGCAAAACAAGTTAAAGCTTTCATCAGAGAGCTCTTTGATCAGAACCCACTGAGTCAAATCGGTCTGGTAACTATAAAAGATGGGGTTGCTCAGTGTTTAACCGATCTTGGTGGTAGCCCGGAGTCTCATATTAAAGCCTTGGCAGGAAAATTGGAGTGCTCGGGTGATTCCTCCATTCAAAATGCTTTAGATCTTGTACACGACTTTCTTAATCAAATCCCATCATACGGCCACCATGAAGTTCTTATCTTGTATTCGGCTCTTAGTACTTGCGATCCGGGCGATATAATGGAAACCATCCAGAAATGCAAGAAATCTAAGATGAGGTGTTCGCTGTTTTTATCGGGTTTAAAAAATGCAGGAAACATGCCAGGGCCTTGTGTTGCCTGCCTGAAATGCAAACAACATTTTTGCCTCGAGTGCGACATTTACATCCACGAGAGTTTGCACAATTGCCCCGGTTGTGAGAGCTTCAGGCAACCCAAGTCTCTCACTGTTACTCAAGAATGA

Network for GWHGAAZE000879

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04056.15	Ssl1	1	123	2.00E-49
PF07975.13	C1_4	135	168	3.60E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03142	TFIIH2, GTF2H2, SSL1	Basal transcription factors	map03022
K03142	TFIIH2, GTF2H2, SSL1	Nucleotide excision repair	map03420

Gene Ontology

GO term	Ontology	Name
GO:0006281	biological_process	DNA repair
GO:0008270	molecular_function	zinc ion binding
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.450
	SRR3591706	second leaf	6.206
	SRR3591707	mature leaf	7.024
	SRR3591708	Shoot apex	11.169
	SRR3591709	Stem	6.631
	SRR3591710	White floral bud	8.688
	SRR3591711	White flower	9.627
	SRR3591712	Green floral bud	10.607
	SRR3591713	Yellow flower	4.019
SRP173429	SRR8316895	Juvenile bud stage	8.162
	SRR8316896	Juvenile bud stage	8.043
	SRR8316897	Juvenile bud stage	3.654
	SRR8316894	Third green stage	4.323
	SRR8316900	Third green stage	11.322
	SRR8316901	Third green stage	9.658
	SRR8316898	Complete white stage	1.693
	SRR8316899	Complete white stage	14.040
	SRR8316903	Complete white stage	3.869
	SRR8316902	Silver flowering stage	1.797
	SRR8316904	Silver flowering stage	2.762
	SRR8316905	Silver flowering stage	0.640
	SRR8316906	Gold flowering stage	3.336
	SRR8316907	Gold flowering stage	2.892
	SRR8316908	Gold flowering stage	3.855
SRP132670	SRR6706286	Control	5.541
	SRR6706287	Light intensity 50%	6.335
	SRR6706288	Light intensity 20%	6.145
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.323
	CNS0095593	Slightly white alabastrum(diploid) 2	7.406
	CNS0095594	Slightly white alabastrum(diploid) 3	6.920
	CNS0095595	Whole white alabastrum(diploid) 2	4.972
	CNS0095596	Whole white alabastrum(diploid) 3	7.395
	CNS0095597	Whole white alabastrum(diploid) 4	5.412
	CNS0095598	Silvery flower (diploied) 1	11.445
	CNS0095599	Silvery flower (diploied) 2	7.769
	CNS0095600	Silvery flower (diploied) 3	6.414
	CNS0095601	Golden flower (diploid) 1	8.145
	CNS0095602	Golden flower (diploid) 2	6.969
	CNS0095603	Golden flower (diploid) 3	4.806
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.839
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.620
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.390
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.747
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.451
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.365
	CNS0095610	Silvery flower (tetraploid) 1	5.425
	CNS0095611	Silvery flower (tetraploid) 2	8.748
	CNS0095612	Silvery flower (tetraploid) 3	4.354
	CNS0095613	Golden flower (tetraploid) 1	2.410
	CNS0095614	Golden flower (tetraploid) 2	2.805
	CNS0095615	Golden flower (tetraploid) 3	1.846
CRA001975	CRR073297	Stem 1	8.919
	CRR073298	Stem 2	5.763
	CRR073299	Stem 3	2.523
	CRR073300	Leaf 1	5.454
	CRR073301	Leaf 2	5.774
	CRR073302	Leaf 3	3.592
	CRR073303	Juvenile bud 1	2.438
	CRR073304	Juvenile bud 2	1.059
	CRR073305	Juvenile bud 3	2.833
	CRR073306	Third green 1	0.500
	CRR073307	Third green 2	0.234
	CRR073308	Third green 3	0.272
	CRR073309	Second white 1	0.083
	CRR073310	Second white 2	0.749
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.112
	CRR073313	Silver flowering 2	0.443
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.219
	CRR073316	Gold flowering 2	2.444
	CRR073317	Gold flowering 3	1.470
	CRR073318	Tawny withering 1	2.872
	CRR073319	Tawny withering 2	5.710
	CRR073320	Tawny withering 3	4.279