Gene detail

Detail information of GWHGAAZE000872

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007009739.1	5.6934E-108	ATP synthase D chain, mitochondrial [Theobroma cacao]
Swissprot	tr\|Q9FT52\|ATP5H_ARATH	3E-99	ATP synthase subunit d, mitochondrial
trEMBL	tr\|A0A061FUR0\|A0A061FUR0_THECC	2E-108	ATP synthase D chain, mitochondrial {ECO:0000313\|EMBL:EOY18549.1}
TAIR10	AT3G52300.1	5E-65	ATP synthase D chain, mitochondrial

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	18465384	18470710	+
GWHAAZE00000001	mRNA	18465384	18470710	+
GWHAAZE00000001	exon	18465384	18465554	+
GWHAAZE00000001	exon	18467544	18467625	+
GWHAAZE00000001	exon	18469311	18469375	+
GWHAAZE00000001	exon	18469855	18469941	+
GWHAAZE00000001	exon	18470277	18470710	+
GWHAAZE00000001	CDS	18465384	18465554	+
GWHAAZE00000001	CDS	18467544	18467625	+
GWHAAZE00000001	CDS	18469311	18469375	+
GWHAAZE00000001	CDS	18469855	18469941	+
GWHAAZE00000001	CDS	18470277	18470378	+
GWHAAZE00000001	three_prime_UTR	18470379	18470710	+

Transcript Sequence
>GWHTAAZE000874 ATGAGCGGAGCAGGGAAGAAGGTGGTGGATGTAGCATTCAAGGCATCAAAGAGCATAGATTGGGAAGGCATGGCAAAGCTTCTCGGCTCCGATGAGGCTCGGAAGGAATTCGCCACCCTTCGACGTGCCTTTGATGAAGTTAATTCTACTCTCCAAACCAAATTCAGTCAGGAACCAGAGTCGATAGACTGGGAATATTATAGGAAAGGAATTGGCTCCCGCTTGGTTGATATGTACAAAGAAGCATATGATAGTGTTGAAATCCCGAAGTATGTGGACAATGTCACACTTCAGTACAAACCCAAGTTCGATTCACTGTTGGTGGAACTGAAAGAAGCAGAAGAGAAATCCCTGAAGAAGTCTGAAAGATTAGAAAAAGAAATTGCCGAAGTTAAAGAGCTGAAGAAGAAGCTTAGCACAATGACTGCGGATGAATACTTCGAGAAGCATCCAGAGCTGAAGAAGAAGTTTGATGATGAAATCCGAAACGATTATTGGGGCTATTGATCTTATTAGCATTGCGCCAATGGTGTTCTCGTAGGCTTTAGCCATCTGCCTGAGGTGAACCAAAACCCTATTTGAATTAAATCCTATTTTGTTTTTGCCTTTTAGAAAATAAAAGGGAGGAGTCCAGTCTATGATTTGGTTGCTTTTGGGTATTTTGAAAATATGTTTCATTTGTGAGAAATTTGAATTCAGTCTCTAGAAAGGCAAACAATGATCAAACATGAGTCGGCTTTCATTTGTATCTACTTTAGTTGTTTTTAGGTCAATTGTCTTGGATATTCAATAAGAAGGGGATATTTACGATCACATATTTCATTTCATTGGTTTTGTTG

Network for GWHGAAZE000872

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05873.13	Mt_ATP-synt_D	15	166	4.20E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02138	ATPeF0D, ATP5H, ATP7	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0000276	cellular_component	mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.204
	SRR3591706	second leaf	3.804
	SRR3591707	mature leaf	4.912
	SRR3591708	Shoot apex	6.939
	SRR3591709	Stem	14.847
	SRR3591710	White floral bud	13.211
	SRR3591711	White flower	14.271
	SRR3591712	Green floral bud	18.618
	SRR3591713	Yellow flower	15.213
SRP173429	SRR8316895	Juvenile bud stage	10.485
	SRR8316896	Juvenile bud stage	22.080
	SRR8316897	Juvenile bud stage	8.932
	SRR8316894	Third green stage	8.458
	SRR8316900	Third green stage	27.197
	SRR8316901	Third green stage	23.672
	SRR8316898	Complete white stage	5.564
	SRR8316899	Complete white stage	13.831
	SRR8316903	Complete white stage	8.795
	SRR8316902	Silver flowering stage	4.793
	SRR8316904	Silver flowering stage	6.358
	SRR8316905	Silver flowering stage	2.902
	SRR8316906	Gold flowering stage	7.181
	SRR8316907	Gold flowering stage	15.137
	SRR8316908	Gold flowering stage	5.074
SRP132670	SRR6706286	Control	14.986
	SRR6706287	Light intensity 50%	14.823
	SRR6706288	Light intensity 20%	14.101
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.039
	CNS0095593	Slightly white alabastrum(diploid) 2	25.707
	CNS0095594	Slightly white alabastrum(diploid) 3	30.881
	CNS0095595	Whole white alabastrum(diploid) 2	32.041
	CNS0095596	Whole white alabastrum(diploid) 3	45.194
	CNS0095597	Whole white alabastrum(diploid) 4	35.937
	CNS0095598	Silvery flower (diploied) 1	13.338
	CNS0095599	Silvery flower (diploied) 2	15.723
	CNS0095600	Silvery flower (diploied) 3	12.179
	CNS0095601	Golden flower (diploid) 1	11.970
	CNS0095602	Golden flower (diploid) 2	9.439
	CNS0095603	Golden flower (diploid) 3	8.169
	CNS0095604	Slightly white alabastrum(tetraploid) 1	48.097
	CNS0095605	Slightly white alabastrum(tetraploid) 2	42.080
	CNS0095606	Slightly white alabastrum(tetraploid) 3	20.621
	CNS0095607	Whole white alabastrum(tetraploid) 1	49.306
	CNS0095608	Whole white alabastrum(tetraploid) 2	49.530
	CNS0095609	Whole white alabastrum(tetraploid) 3	39.040
	CNS0095610	Silvery flower (tetraploid) 1	10.983
	CNS0095611	Silvery flower (tetraploid) 2	8.553
	CNS0095612	Silvery flower (tetraploid) 3	13.164
	CNS0095613	Golden flower (tetraploid) 1	5.941
	CNS0095614	Golden flower (tetraploid) 2	8.495
	CNS0095615	Golden flower (tetraploid) 3	2.620
CRA001975	CRR073297	Stem 1	20.162
	CRR073298	Stem 2	22.477
	CRR073299	Stem 3	14.274
	CRR073300	Leaf 1	23.204
	CRR073301	Leaf 2	22.650
	CRR073302	Leaf 3	21.600
	CRR073303	Juvenile bud 1	21.503
	CRR073304	Juvenile bud 2	17.605
	CRR073305	Juvenile bud 3	11.913
	CRR073306	Third green 1	6.441
	CRR073307	Third green 2	8.096
	CRR073308	Third green 3	8.802
	CRR073309	Second white 1	5.726
	CRR073310	Second white 2	7.380
	CRR073311	Second white 3	4.987
	CRR073312	Silver flowering 1	3.880
	CRR073313	Silver flowering 2	6.867
	CRR073314	Silver flowering 3	4.173
	CRR073315	Gold flowering 1	12.332
	CRR073316	Gold flowering 2	13.712
	CRR073317	Gold flowering 3	6.109
	CRR073318	Tawny withering 1	21.393
	CRR073319	Tawny withering 2	12.706
	CRR073320	Tawny withering 3	18.548