Gene detail

Detail information of GWHGAAZE000192

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010245350.1	1.1094E-106	PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 isoform X1 [Nelumbo nucifera]
COG	YP_007319498.1	2E-29	flavin-containing monooxygenase FMO
Swissprot	tr\|Q9FVQ0\|YUC10_ARATH	2E-71	Probable indole-3-pyruvate monooxygenase YUCCA10
trEMBL	tr\|A0A061DS63\|A0A061DS63_THECC	8E-103	Flavin-containing monooxygenase {ECO:0000256\|RuleBase:RU361177}
TAIR10	AT1G48910.1	1E-59	Flavin-containing monooxygenase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	3903334	3905830	+
GWHAAZE00000001	mRNA	3903334	3905830	+
GWHAAZE00000001	exon	3903334	3903422	+
GWHAAZE00000001	exon	3903733	3903955	+
GWHAAZE00000001	exon	3904243	3904476	+
GWHAAZE00000001	exon	3905663	3905830	+
GWHAAZE00000001	CDS	3903334	3903422	+
GWHAAZE00000001	CDS	3903733	3903955	+
GWHAAZE00000001	CDS	3904243	3904476	+
GWHAAZE00000001	CDS	3905663	3905830	+

Transcript Sequence
>GWHTAAZE000192 ATGGAGATTCAAGAACACGTTGTGATCGTGGTCGGAGCCGGCCCATCGGGCCTAGCCACTGCAGCCTGCCTAAGCCAACTCTCGATCCCATTTTTAGTGGTAGCAACAGGTGAAACTAGCGATGCATTTGTGCCTGAAGTTGAAGGATTGAGTAGCTTTAAAGGGGAAGTTTTTCATTCAACTCAATACAAGAATGGAGAAAGTTATAGTGACAAAAATGTATTGGTGGTAGGGGCTGGAAACTCCGGCATGGAGATTGCATTTGATTTGTCTAATTATGGTGCTAAAACCTCCATTGTTGTTCGAAGCCCGATTCATATTTTATCAAGGGGAATGGTGTACATGGGGTTGATTCTGCTGAAATACATACCATATTATGTGGTGGAATCATTGATGGTGATACTTAGCAAGATCAGATATGGAGATCTTACCAAATATGGTATTGAAAGGCCACAAGAAGGTCCATTTTCTTTGAAAGTAAAGTACGGTAAATACCCGGTCATCGACATGGGGACTTGCAAGAAAATCAAGACCGGCGAAATTCAGGGAGATGATTATCTATTGAATGACGAAGGGTTACCAAAACCAAGTTTTCCAAATCATTGGAAAGGGAAAAAGGGATTGTATTGTGTTGGACTTGCAAGGAGAGGACTCTATGGAGCTGCAATGGATGCCCAAAATATTGCCAACCATATCAACACGTTACTTAATTGA

Network for GWHGAAZE000192

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00743.20	FMO-like	33	111	2.70E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11816	YUCCA	Metabolic pathways	map01100
K11816	YUCCA	Tryptophan metabolism	map00380

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0004499	molecular_function	N,N-dimethylaniline monooxygenase activity
GO:0050660	molecular_function	flavin adenine dinucleotide binding
GO:0050661	molecular_function	NADP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.542
	SRR3591706	second leaf	14.069
	SRR3591707	mature leaf	4.544
	SRR3591708	Shoot apex	12.762
	SRR3591709	Stem	14.470
	SRR3591710	White floral bud	2.714
	SRR3591711	White flower	1.084
	SRR3591712	Green floral bud	2.558
	SRR3591713	Yellow flower	39.473
SRP173429	SRR8316895	Juvenile bud stage	3.751
	SRR8316896	Juvenile bud stage	2.977
	SRR8316897	Juvenile bud stage	1.246
	SRR8316894	Third green stage	1.141
	SRR8316900	Third green stage	1.587
	SRR8316901	Third green stage	1.353
	SRR8316898	Complete white stage	0.119
	SRR8316899	Complete white stage	0.223
	SRR8316903	Complete white stage	0.185
	SRR8316902	Silver flowering stage	0.078
	SRR8316904	Silver flowering stage	0.220
	SRR8316905	Silver flowering stage	0.099
	SRR8316906	Gold flowering stage	1.031
	SRR8316907	Gold flowering stage	0.282
	SRR8316908	Gold flowering stage	0.286
SRP132670	SRR6706286	Control	1.198
	SRR6706287	Light intensity 50%	0.571
	SRR6706288	Light intensity 20%	0.336
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.539
	CNS0095593	Slightly white alabastrum(diploid) 2	0.488
	CNS0095594	Slightly white alabastrum(diploid) 3	2.344
	CNS0095595	Whole white alabastrum(diploid) 2	0.150
	CNS0095596	Whole white alabastrum(diploid) 3	1.041
	CNS0095597	Whole white alabastrum(diploid) 4	0.307
	CNS0095598	Silvery flower (diploied) 1	1.033
	CNS0095599	Silvery flower (diploied) 2	1.298
	CNS0095600	Silvery flower (diploied) 3	0.399
	CNS0095601	Golden flower (diploid) 1	0.234
	CNS0095602	Golden flower (diploid) 2	7.668
	CNS0095603	Golden flower (diploid) 3	7.287
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.447
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.639
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.701
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.139
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.118
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.994
	CNS0095610	Silvery flower (tetraploid) 1	0.532
	CNS0095611	Silvery flower (tetraploid) 2	0.632
	CNS0095612	Silvery flower (tetraploid) 3	1.749
	CNS0095613	Golden flower (tetraploid) 1	4.875
	CNS0095614	Golden flower (tetraploid) 2	2.873
	CNS0095615	Golden flower (tetraploid) 3	10.213
CRA001975	CRR073297	Stem 1	2.266
	CRR073298	Stem 2	1.697
	CRR073299	Stem 3	1.299
	CRR073300	Leaf 1	0.169
	CRR073301	Leaf 2	0.174
	CRR073302	Leaf 3	0.538
	CRR073303	Juvenile bud 1	0.164
	CRR073304	Juvenile bud 2	0.081
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.033
	CRR073308	Third green 3	0.026
	CRR073309	Second white 1	0.117
	CRR073310	Second white 2	0.471
	CRR073311	Second white 3	0.167
	CRR073312	Silver flowering 1	4.716
	CRR073313	Silver flowering 2	3.059
	CRR073314	Silver flowering 3	4.827
	CRR073315	Gold flowering 1	0.445
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.059
	CRR073318	Tawny withering 1	2.055
	CRR073319	Tawny withering 2	1.550
	CRR073320	Tawny withering 3	1.446